NSP3 (SH2D3C) (NM_170600) Human 3' UTR Clone

CAT#: SC205934

3' UTR clone of SH2 domain containing 3C (SH2D3C) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "SH2D3C"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SH2D3C
Synonyms CHAT; NSP3; PRO34088; SHEP1
ACCN NM_170600
Insert Size 459 bp
Sequence Data
>SC205934 3’UTR clone of NM_170600
The sequence shown below is from the reference sequence of NM_170600. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAACCTGCTGTCCGCTCCAGCGAGCTGTGACCCCAGGGACATTTCCCCTCTGCAGCTGCGGACAGCGTC
AGGGGCAGAGGGGCACACAACTTTCCCCAGAGCACCCCAAGGACACTGTGATCAACCCGAGAATGTTCT
GGGTTCAACTCAAGCATCTCCCTTGCACCTCCAGGGTCCTGCGTGGACTCTGGGTTCCATCCCACCTGC
TACATGCTCACCAGGTCTCCATTGAGGAAGAACAGGAACGCCGGTTCCCCCACCAGCTTTTGCTGCTCC
CCTTCCTGCTGGGGTTCCCTGTTTTCGAGCCATGGGAGGCAGGCTGCTCACGCCTCCTCACTCTCTGTC
TGTCCCTCACCAACACCAAGGCCTCCATCTCACTGTAAATAAGTCTCTGTTCTGTAAATAGATGTACAG
AAGCCATGTTATTTCTTTCATATAATAAACTTTTATGACTCTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_170600.3
Summary This gene encodes an adaptor protein and member of a cytoplasmic protein family involved in cell migration. The encoded protein contains a putative Src homology 2 (SH2) domain and guanine nucleotide exchange factor-like domain which allows this signaling protein to form a complex with scaffolding protein Crk-associated substrate. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Locus ID 10044
MW 16.5

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.