Apc11 (ANAPC11) (NM_016476) Human 3' UTR Clone

CAT#: SC205689

3' UTR clone of anaphase promoting complex subunit 11 (ANAPC11) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ANAPC11
• Synonyms: APC11; Apc11p; HSPC214
• ACCN: NM_016476
• Insert Size: 498 bp
• Sequence Data:
  Insert Sequence

  >SC205689 3’UTR clone of NM_016476
  The sequence shown below is from the reference sequence of NM_016476. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  TGCCGCCAGGAATGGAAGTTCAAGGAGTGAGGCCCGACCTGGCTCTCGCTGGAGGGGCATCCTGAGACT
  CCTTCCTCATGCTGGCGCCGATGGCTGCTGGGGACAGCGCCCCTGAGCTGCAACAAGGTGGAAACAAGG
  GCTGGAGCTGCGTTTGTTTTGCCATCACTATGTTGACACTTTTATCCAATAAGTGAAAACTCATTAAAC
  TACTCAAATCTTGCTGGAGGCCTCTGGGTGCCTGTGTTCTCGGCATATAGATGTGGTCTCGGTGTGTTT
  TGATATGAAAACTCTCATGAATAAACATCTCCGTGAAACGCCAAGGCCCTCGTCAAACCCTGAGTCATG
  ACTGGGAGGAGAAGGAGCAGGATCAGACGGTAGAGCCTGGGGCATGCTCTTCAGGCATGCTCTTGCCTG
  CTGGATTGCCGGCGGCGGCCCTGGGACCCTCCCTCAGGCTGGCTCTGAGGGACCCTGGCTGTGCAAAGC
  TGGCGGCCACTGCTT
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_016476.11
• Summary: Together with the cullin protein ANAPC2, constitutes the catalytic component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of 'Lys-11'-linked polyubiquitin chains and, to a lower extent, the formation of 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains. May recruit the E2 ubiquitin-conjugating enzymes to the complex.[UniProtKB/Swiss-Prot Function]
• Locus ID: 51529
• MW: 18.8