DISC1 (NM_001164539) Human 3' UTR Clone

CAT#: SC204766

3' UTR clone of disrupted in schizophrenia 1 (DISC1) transcript variant c for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "DISC1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DISC1
Synonyms C1orf136; SCZD9
ACCN NM_001164539
Insert Size 385 bp
Sequence Data
>SC204766 3’UTR clone of NM_001164539
The sequence shown below is from the reference sequence of NM_001164539. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATGAGCCACTGTGCCTGGCCCCTACAATAATTCTTTAATGTGAGGAAATATCAAATGAAAAATAAGAAA
TTCTAGGTAAGGAAAGAAATTTATTTAGTGGAAGTATAAAAGAAGTTTAAAAAGTTGAAGAAAATTTTG
GTTTTCAATGTTGATGCAGCGTCCTTTGTGAATCTTTAAATTTGTGAATGACACTTTTGAAAACTTACA
CCTTATTCTAAGTGTCTTTGTTCACTTTACACTGTACTGTAAAGAATCACAAGAGTGTCTCATAAATAA
CTTTCTATATAACATATGTATATTTCAAAATAACATGTTATATATATAATACATACAATTTTTGTCAAT
TAAACAGTACATTAAAAAGACAAAAATAACTTTCCATAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001164539.2
Summary This gene encodes a protein with multiple coiled coil motifs which is located in the nucleus, cytoplasm and mitochondria. The protein is involved in neurite outgrowth and cortical development through its interaction with other proteins. This gene is disrupted in a t(1;11)(q42.1;q14.3) translocation which segregates with schizophrenia and related psychiatric disorders in a large Scottish family. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Locus ID 27185
MW 15.2

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.