TRIF (TICAM1) (NM_182919) Human 3' UTR Clone

CAT#: SC204386

3' UTR clone of toll-like receptor adaptor molecule 1 (TICAM1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TICAM1
• Synonyms: IIAE6; MyD88-3; PRVTIRB; TICAM-1; TRIF
• ACCN: NM_182919
• Insert Size: 337 bp
• Sequence Data:
  Insert Sequence

  >SC204386 3’UTR clone of NM_182919
  The sequence shown below is from the reference sequence of NM_182919. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  CCCGAGGACAAGACGCAGGAGGCAGAATGACCGCGTGTCCTTGCCTGACCACCTGGGGAACACCCCTGG
  ACCCAGGCATCGGCCAGGACCCCATAGAGCACCCCGGTCTGCCCTGTGCCCTGTGGACAGTGGAAGATG
  AGGTCATCTGCCACTTTCAGGACATTGTCCGGGAGCCCTTCATTTAGGACAAAACGGGCGCGATGATGC
  CCTGGCTTTCAGGGTGGTCAGAACTGGATACGGTGTTTACAATTCCAATCTCTCTATTTCTGGGTGAAG
  GGTCTTGGTGGTGGGGGTATTGCTACGGTCTTTTAATTATAATAAATATTTATTGAATGCT
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_182919.4
• Summary: This gene encodes an adaptor protein containing a Toll/interleukin-1 receptor (TIR) homology domain, which is an intracellular signaling domain that mediates protein-protein interactions between the Toll-like receptors (TLRs) and signal-transduction components. This protein is involved in native immunity against invading pathogens. It specifically interacts with toll-like receptor 3, but not with other TLRs, and this association mediates dsRNA induction of interferon-beta through activation of nuclear factor kappa-B, during an antiviral immune response. Mutations in this gene are associated with encephalopathy, acute, infection-induced. [provided by RefSeq, Jul 2020]
• Locus ID: 148022
• MW: 12.4