CMTM1 (NM_181268) Human 3' UTR Clone

CAT#: SC203952

3`UTR clone of CKLF-like MARVEL transmembrane domain containing 1 (CMTM1) transcript variant 18 for miRNA target validation

USD 540.00


Availability*
4 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name CMTM1 (NM_181268) Human 3' UTR Clone
Vector pMirTarget
Symbol CMTM1
Synonyms CKLFH; CKLFH1; CKLFSF1
ACCN NM_181268
Insert Size 285
Sequence Data
>SC203952 3'UTR clone of NM_181268
The sequence shown below is from the reference sequence of NM_181268. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGGCATTTACTCTATGTCGGGGGGCGGTAATCGTGTGTTGCATCGATGCGTTTGTGGTCACCACGAAGAT
GAGGACCAACTTGAAAAGATTCCTGGGAGTCGAAGTTGAAAGGAAGCTTTCCCCCGCCAAGGACGCCTAC
CCCGAAACCGGCCCCGACGCCCCGCAGAGGCCCGCCTGAAGCCAGCCCGGCGCCCTAGCAGATGCACGTG
TCTGTCGAATCGCTGCCTCCGAGCCCACCCCCGAGCTCGCATGCTGTCACCCATTCCAGCCTAAATGTGA
CCATA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_181268.2
Synonyms CKLFH; CKLFH1; CKLFSF1
Summary This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and the transmembrane 4 superfamilies of signaling molecules. The protein encoded by this gene may play an important role in testicular development. Alternatively spliced transcript variants encoding different isoforms have been identified. Naturally occurring read-through transcription occurs between this locus and the neighboring locus CKLF (chemokine-like factor).[provided by RefSeq, Feb 2011].
Locus ID 113540

Documents

Other products for "CMTM1"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones