PDE9A (NM_001001581) Human 3' UTR Clone

CAT#: SC203221

3' UTR clone of phosphodiesterase 9A (PDE9A) transcript variant 16 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PDE9A
• Synonyms: HSPDE9A2
• ACCN: NM_001001581
• Insert Size: 246 bp
• Sequence Data:
  Insert Sequence

  >SC203221 3’UTR clone of NM_001001581
  The sequence shown below is from the reference sequence of NM_001001581. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GTGAAAAACAGTGAAGGAGACTGTGCCTGAGGAAAGCGGGGGGCGTGGCTGCAGTTCTGGACGGGCTGG
  CCGAGCTGCGCGGGATCCTTGTGCAGGGAAGAGCTGCCCTGGGCACCTGGCACCACAAGACCATGTTTT
  CTAAGAACCATTTTGTTCACTGATACAAAAAAAAAAAAAGGAATTCATGATGCTGTACAGAATTTTATT
  TTTAAACTGTCTTTTAAATAATATATTCTTATACGGAAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001001581.2
• Summary: The protein encoded by this gene catalyzes the hydrolysis of cAMP and cGMP to their corresponding monophosphates. The encoded protein plays a role in signal transduction by regulating the intracellular concentration of these cyclic nucleotides. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
• Locus ID: 5152
• MW: 9.4