POGLUT2 (NM_024089) Human 3' UTR Clone

SKU
SC202830
3' UTR clone of KDEL (Lys-Asp-Glu-Leu) containing 1 (KDELC1) for miRNA target validation
$683.00
4 Weeks*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol POGLUT2
Synonyms EP58; ERp58; KDEL1; KDELC1
ACCN NM_024089
Insert Size 244 bp
Sequence Data
Insert Sequence
>SC202830 3’UTR clone of NM_024089
The sequence shown below is from the reference sequence of NM_024089. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CATAGGAAAAAGACCAAAGATGAACTCTGATATGCAAAATAACTTCTATTAGAATAATGGTGCTCTGAA
GACTCTTCTTAACTAAAAAGAAGAATTTTTTTAAGTATTAATTCCATGGACAATATAAAATCTGTGTGA
TTGTTTGCAGTATGAAGACACATTTCTACTTATGCAGTATTCTCATGACTGTACTTTAAAGTACATTTT
TAGAATTTTATAATAAAACCACCTTTATTTTAAAGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_024089.3
Locus ID 79070
Summary This gene encodes a protein product localized to the lumen of the endoplasmic reticulum. As a member of the endoplasmic reticulum protein family the encoded protein contains a Lys-Asp-Glu-Leu or KDEL motif located at the extreme C-terminus which prevents all endoplasmic reticulum resident proteins from being secreted. Proteins carrying this motif are bound by a receptor in the Golgi apparatus so that the receptor-ligand complex returns to the endoplasmic reticulum. A processed non-transcribed pseudogene located in an intron of a sodium transporter gene on chromosome 5 has been defined for this gene. This gene has multiple transcript variants which are predicted to encode distinct isoforms. [provided by RefSeq, Jan 2016]
Write Your Own Review
You're reviewing:POGLUT2 (NM_024089) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.