CPNE1 (NM_152926) Human 3' UTR Clone

CAT#: SC202483

3' UTR clone of copine I (CPNE1) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "CPNE1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CPNE1
Synonyms COPN1; CPN1
ACCN NM_152926
Insert Size 227 bp
Sequence Data
>SC202483 3’UTR clone of NM_152926
The sequence shown below is from the reference sequence of NM_152926. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGGATCCTGCACAGGCCCCCCAGGCCTAGGTTCCCTTGGAGGCTGTGGCAAGTCCTCAATCCTGTGTC
CCAGAGGTCCCTCTGGGCCACAACCCAACCCTTCTCACTCTCCTCAGTGCTAGCACTTTGTATTTTTTG
ATACTTTTATACTTGTTTCTGCTTTTGCTGCTCTTGATCCCACCTTTGCTCCTGACAACCCTCATTCAA
TAAAGACCAGTGAAGACCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_152926.3
Summary Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene encodes a calcium-dependent protein that also contains two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. However, the encoded protein does not contain a predicted signal sequence or transmembrane domains. This protein has a broad tissue distribution and it may function in membrane trafficking. This gene and the gene for RNA binding motif protein 12 overlap at map location 20q11.21. Alternate splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Aug 2008]
Locus ID 8904
MW 8.2

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.