AKR1C3 (NM_003739) Human 3' UTR Clone

CAT#: SC201954

3' UTR clone of aldo-keto reductase family 1 member C3 (3-alpha hydroxysteroid dehydrogenase type II) (AKR1C3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: AKR1C3
• Synonyms: DD3; DDX; HA1753; HAKRB; HAKRe; hluPGFS; HSD17B5; PGFS
• ACCN: NM_003739
• Insert Size: 201 bp
• Sequence Data:
  Insert Sequence

  >SC201954 3' UTR clone of NM_003739
  The sequence shown below is from the reference sequence of NM_003739. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTTTTGCTAGCCACCCTAATTATCCATATTCAGATGAATATTAACATGGAGGGCTTTGCCTGATGTCTAC
  CAGAAGCCCTGTGTGTGGATGGTGACGCAGAGGACGTCTCTATGCCGGTGACTGGACATATCACCTCTAC
  TTAAATCCGTCCTGTTTAGCGACTTCAGTCAACTACAGCTGAGTCCATAGGCCAGAAAGAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003739.4
• Summary: This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols by utilizing NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme catalyzes the reduction of prostaglandin (PG) D2, PGH2 and phenanthrenequinone (PQ), and the oxidation of 9alpha,11beta-PGF2 to PGD2. It may play an important role in the pathogenesis of allergic diseases such as asthma, and may also have a role in controlling cell growth and/or differentiation. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
• Locus ID: 8644