NCF1 (NM_000265) Human 3' UTR Clone

SKU
SC201664
3' UTR clone of neutrophil cytosolic factor 1 (NCF1) for miRNA target validation
$683.00
4 Weeks*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol NCF1
Synonyms CGD1; NCF1A; NOXO2; p47phox; SH3PXD1A
ACCN NM_000265
Insert Size 185 bp
Sequence Data
Insert Sequence
>SC201664 3’UTR clone of NM_000265
The sequence shown below is from the reference sequence of NM_000265. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCAAGCGGAAGCTGGCGTCTGCCGTCTGAGGCTGGAGCGCAGTCCCCAGCTAGCGTCTCGGCCCTTGC
CGCCCCGTGCCTGTATATACGTGTTCTATAGAGCCTGGCGTCTGGACGCCGAGGGCAGCCCCGACCCCT
GTCCAGCGCGGCTCCCGCCACCCTCAATAAATGTTGCTTGGAGTGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000265.7
Locus ID 653361
Summary The protein encoded by this gene is a 47 kDa cytosolic subunit of neutrophil NADPH oxidase. This oxidase is a multicomponent enzyme that is activated to produce superoxide anion. Mutations in this gene have been associated with chronic granulomatous disease. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:NCF1 (NM_000265) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.