SKP2 (NM_005983) Human 3' UTR Clone

CAT#: SC201297

3`UTR clone of S-phase kinase-associated protein 2 (p45) (SKP2) transcript variant 1 for miRNA target validation

Change vector?

USD 526.00


Availability*
5 Days

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name SKP2 (NM_005983) Human 3' UTR Clone
Vector pMirTarget
Symbol SKP2
Synonyms FBL1; FBXL1; FLB1; p45
ACCN NM_005983
Insert Size 182
Sequence Data
Insert Sequence
>SC201297 3'UTR clone of NM_005983
The sequence shown below is from the reference sequence of NM_005983. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAAATGCCGACTGACACTGCAAAAGCCCAGTTGTCTATGAAGTATTTATTGCAGGATGGTGTCTCTTCTT
TAGAACAGGGAAAATAGGCAGGAAGCCCAATTGCTGGAGTACTTAGCTAGTTTTATTCTTGGTTTTCCCT
TTGCCTTCATTCTGCAAGTATACTAGGGAGCCATTTGAGAGG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_005983.2
Synonyms FBL1; FBXL1; FLB1; p45
Summary This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class; in addition to an F-box, this protein contains 10 tandem leucine-rich repeats. This protein is an essential element of the cyclin A-CDK2 S-phase kinase. It specifically recognizes phosphorylated cyclin-dependent kinase inhibitor 1B (CDKN1B, also referred to as p27 or KIP1) predominantly in S phase and interacts with S-phase kinase-associated protein 1 (SKP1 or p19). In addition, this gene is established as a protooncogene causally involved in the pathogenesis of lymphomas. Alternative splicing of this gene generates three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2011]
Locus ID 6502
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents