HLAF (HLA-F) (NM_001098479) Human 3' UTR Clone

CAT#: SC201220

3' UTR clone of major histocompatibility complex class I F (HLA-F) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HLA-F
• Synonyms: CDA12; HLA-5.4; HLA-CDA12; HLAF
• ACCN: NM_001098479
• Insert Size: 151 bp
• Sequence Data:
  Insert Sequence

  >SC201220 3’UTR clone of NM_001098479
  The sequence shown below is from the reference sequence of NM_001098479. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  AAAAGGGTCCAGATTAAGATTTTTGACTGAGTCATTCTAAAGTAAGTTGCAAGACCCATGATACTAGAC
  CACTAAATACTTCATCACACACCTCCTAAGAATAAGAACCAACATTATCACACCAAAGAAAATAAATAA
  TTCCATAATATTA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001098479.2
• Summary: This gene belongs to the HLA class I heavy chain paralogues. It encodes a non-classical heavy chain that forms a heterodimer with a beta-2 microglobulin light chain, with the heavy chain anchored in the membrane. Unlike most other HLA heavy chains, this molecule is localized in the endoplasmic reticulum and Golgi apparatus, with a small amount present at the cell surface in some cell types. It contains a divergent peptide-binding groove, and is thought to bind a restricted subset of peptides for immune presentation. This gene exhibits few polymorphisms. Multiple transcript variants encoding different isoforms have been found for this gene. These variants lack a coding exon found in transcripts from other HLA paralogues due to an altered splice acceptor site, resulting in a shorter cytoplasmic domain. [provided by RefSeq, Jul 2008]
• Locus ID: 3134
• MW: 6.1