Dectin 1(CLEC7A) (NM_197954) Human 3' UTR Clone

CAT#: SC200577

3`UTR clone of C-type lectin domain family 7 member A (CLEC7A) transcript variant 6 for miRNA target validation

Clone Modification / Custom Cloning Service

USD 526.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Dectin 1(CLEC7A) (NM_197954) Human 3' UTR Clone
Vector pMirTarget
Symbol CLEC7A
Synonyms BGR; CANDF4; CD369; CLECSF12; DECTIN1; SCARE2
ACCN NM_197954
Insert Size 95
Sequence Data
Insert Sequence
>SC200577 3'UTR clone of NM_197954
The sequence shown below is from the reference sequence of NM_197954. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCTGGTTTCAAAGCTGTGGAATTCAAAGGATAAATTAATGAAGAAAACAAGCGGAGCTGAAGAAGAAAGT
ACAATATGGTGCTGTCTTCCTAATG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_197954.2
Synonyms BGR; CANDF4; CD369; CLECSF12; DECTIN1; SCARE2
Summary This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. The encoded glycoprotein is a small type II membrane receptor with an extracellular C-type lectin-like domain fold and a cytoplasmic domain with an immunoreceptor tyrosine-based activation motif. It functions as a pattern-recognition receptor that recognizes a variety of beta-1,3-linked and beta-1,6-linked glucans from fungi and plants, and in this way plays a role in innate immune response. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008].
Locus ID 64581
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents