CABYR (NM_153769) Human 3' UTR Clone

CAT#: SC200576

3' UTR clone of calcium binding tyrosine-(Y)-phosphorylation regulated (CABYR) transcript variant 7 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CABYR
• Synonyms: CABYRa; CABYRc; CABYRc/d; CABYRe; CBP86; CT88; FSP-2; FSP2
• ACCN: NM_153769
• Insert Size: 114 bp
• Sequence Data:
  Insert Sequence

  >SC200576 3’UTR clone of NM_153769
  The sequence shown below is from the reference sequence of NM_153769. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  AAACGTCGCAAAGCAGAAACTGAAAACTGATCCAGAAATGACGCTGTCTGGGTCAACATTTCAGGGAGG
  AGTCTGCCACCAGTGTAATGTATCAATAAACTTCATGCAAGCATA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_153769.3
• Summary: To reach fertilization competence, spermatozoa undergo a series of morphological and molecular maturational processes, termed capacitation, involving protein tyrosine phosphorylation and increased intracellular calcium. The protein encoded by this gene localizes to the principal piece of the sperm flagellum in association with the fibrous sheath and exhibits calcium-binding when phosphorylated during capacitation. A pseudogene on chromosome 3 has been identified for this gene. Alternatively spliced transcript variants encoding distinct protein isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
• Locus ID: 26256
• MW: 4.3