EEF1D (NM_032378) Human 3' UTR Clone

CAT#: SC200297

Reviews ()
Write a review

3`UTR clone of eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) (EEF1D) transcript variant 1 for miRNA target validation

USD 540.00


Availability*
4 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name EEF1D (NM_032378) Human 3' UTR Clone
Vector pMirTarget
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Symbol EEF1D
Synonyms EF-1D; EF1D; FP1047
ACCN NM_032378
Insert Size 99
Sequence Data
>SC200297 3'UTR clone of NM_032378
The sequence shown below is from the reference sequence of NM_032378. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CGTGCAGAGTGTCGATATCGCAGCTTTCAACAAGATCTGAAGCCTGAGTGTGTGTACGTGCGCGCGTGCG
TGAGGCCCTGCCACGATTAAAGACTGAGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_032378.3
Synonyms EF-1D; EF1D; FP1047
Summary This gene encodes a subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This subunit, delta, functions as guanine nucleotide exchange factor. It is reported that following HIV-1 infection, this subunit interacts with HIV-1 Tat. This interaction results in repression of translation of host cell proteins and enhanced translation of viral proteins. Several alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. Related pseudogenes have been defined on chromosomes 1, 6, 7, 9, 11, 13, 17, 19. [provided by RefSeq, Aug 2010]
Locus ID 1936

Documents

Other products for "EEF1D"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones