OriGene Technologies, Inc.
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
GeneDex - A Technical Journal
Product Literature
Webinar
Protocols
Legal Notices
TrueClone cDNA Clones
TrueORF Clones & Shuttle
ExactORF Cloning Service
Over-expression Lysate
Organelle Marker
Purified Protein
MicroRNA
Trilencer-27 siRNA
shRNA Plasmids
Validation Vector
Validated Antibodies
ELISA Antibodies
Transfection Reagents
First-Strand cDNA
TissueScan qPCR Arrays
Primers and Standards
5' End Discovery Panel
Total and Poly A+ RNA
Arrayed cDNA Libraries
Screening Service
Citations
Hot Links


OriGene cDNA clone collection in recent publications
An Unbiased Approach to Identifying Tau Kinases That Phosphorylate Tau at Sites Associated with Alzheimer Disease J. Biol. Chem., Aug 2013; 288: 23331 - 23347. [GFC Kinase Array]

Transmembrane Protein 214 (TMEM214) Mediates Endoplasmic Reticulum Stress-induced Caspase 4 Enzyme Activation and Apoptosis J. Biol. Chem., Jun 2013; 288: 17908 - 17917. [10,000 Clone Collection]

Induction of Pluripotency in Mouse Somatic Cells with Lineage Specifiers Cell. 2013 May 23;153(5):963-75 [10,000 Clone Collection]

RNF34 Is a Cold-Regulated E3 Ubiquitin Ligase for PGC-1a and Modulates Brown Fat Cell Metabolism Mol. Cell. Biol., Jan 2012; 32: 266 - 275. [264 cDNA expression clones]

trans

FAQ: Mammalian shRNA expression plasmids

divider

What is the difference between the pRS expression plasmid , the pGFP-V-RS, and pRFP-C-RS plasmid?
I am doing retroviral packaging and infection, will my infected cells express tGFP or tRFP?
Your HuSH product is stated to be “locus-specific”. How do I know that it will knock down the expression of my variant or isoform?
Can I screen all the constructs provided in HEK293 cells and then pick the most effective one for subsequent studies?
What if the gene is not expressed in HEK293 cells and the transfection efficiency of my target cells is below 80%?
Which method do you recommend for assessing the knockdown efficiency of my gene-specific shRNA constructs?
Can I get a HuSH construct against any species other than human, mouse or rat?
Will your HuSH products work with any retroviral packaging cell line?
How should I use the products?
Can I select for the plasmid-transfected cells?
How can I create a stable cell line with a functional shRNA expression vector?
What use does the empty vector serve?
What use does the scrambled non-effective plasmid serve?
Can you tell me the sequence of your control constructs?
Do I need to use a special strain of E.coli to amplify my HuSH constructs?
Are the HuSH plasmids high copy or low copy number?
Can the pRS, pGFP-V-RS or pRFP-C-RS vectors be packaged by lentivirus?
Do I have to use retroviral packaging and infection to create stable cell lines?
Will 0.5ug/ml-1ug/ml concentration of puromycin work for my cell line?
Which positive control shRNA vector to pick if I purchase shRNA in pGFP-V-RS vector (TG123456)?
What primer should I use to sequence my HuSH plasmids?
What is the OriGene guarantee on the shRNA expression plasmids?
I am writing a paper for publication and need to describe this product. How should I cite?

Q: What is the difference between the pRS expression plasmid , the pGFP-V-RS, and pRFP-C-RS plasmid?
A:
The pGFP-V-RS plasmid contains tGFP driven by a CMV promoter. The pRFP-C-RS plasmid contains tRFP driven by a CMV promoter. Both plasmids provide an easy way to identify cells that have been transfected. The pGFP-V-RS vector is kanamycin resistant, pRFP-C-RS vector is chloramphenicol resistant while the pRS vector is ampicillin resistant.

Q: I am doing retroviral packaging and infection, will my infected cells express tGFP or tRFP?
A:
No. The CMV-tGFP and CMV-tRFP is outside of the region that gets packaged by retrovirus. Thus, you cannot use tGFP or tRFP expression to monitor transduction but you can use puromycin selection to generate stable cell lines.

Q: Your HuSH product is stated to be “locus-specific”. How do I know that it will knock down the expression of my variant or isoform?
A:
Unless stated otherwise, shRNA constructs were designed to be effective against most transcriptional variants at a particular gene locus. If you would like a knockdown construct against a specific transcriptional variant(s), OriGene can generate a custom HuSH product that will selectively knockdown only the specified variants. Please review the options on our ExactshRNA website at www.origene.com/rnai/exactshRNA.aspx

Q: Can I screen all the constructs provided in HEK293 cells and then pick the most effective one for subsequent studies?
A:
Absolutely. We recommend that you screen all constructs individually to identify the most effective constructs. HEK293 cells are a convenient and easily transfectable system for screening all human shRNA constructs (use NIH3T3 for mouse shRNA and OLN-93 for rat shRNA constructs). Other cell lines can also be used for this purpose, so long as the transfection efficiency of our pRS, pGFP-V-RS or pRFP-C-RS vector is high, ~70% or greater for transient transfections. Afterwards, the effective construct(s) can be used for retroviral infection of or for direct transfection into your target cells.

Q: What if the gene is not expressed in HEK293 cells and the transfection efficiency of my target cells is below 80%? How do I screen my shRNA constructs to pick the most effective one?
A:
If your gene is not expressed in HEK293, you can do a co-transfection with an expression construct and the shRNA construct at a 1:1 ratio transiently into HEK293 cells. You can also select stable cells in your target cell line. It is well known that if a gene that is vital for cell growth is silenced, it will be difficult to get stable cells for that particular cell line.

Q: Which method do you recommend for assessing the knockdown efficiency of my gene-specific shRNA constructs?
A:
Western Blot is recommended over qPCR to evaluate the silencing effect of the shRNA constructs 72 hrs post transfection. To properly assess knockdown, the gene expression level from the included scramble control vector must be used in comparison with the target-specific shRNA transfected samples.

Q: Can I get a HuSH construct against any species other than human, mouse or rat?
A:
OriGene can do any custom HuSH design and construction, regardless of species specificity. The only information you need to provide is the accession number of sequence you wish to target. We can offer you assistance in identifying the particular species’ sequences to be used for gene knockdown studies or you can follow the link to our ExactHuSH page

Q: Will your HuSH products work with any retroviral packaging cell line?
A:
Our pRS, pGFP-V-RS and pRFP-C-RS vectors have been designed for viral packaging in most commercially available packaging cell lines. However, please make sure that the packaging line has not been previously transfected with plasmids containing a puromycin resistance cassette. Furthermore, you need to ensure that the chosen packaging line’s viral particles are able to infect your target cell line (some cell lines have restricted species specificity). We suggest packaging lines such as PT67 (Clontech) or Phoenix (Orbigen) for use with our constructs for human and mouse cell line infection.

Q: How should I use the products?
A:
Customers can use the 5 ug shRNA DNA plasmid directly for transfection and gene-knockdown studies. After transfection, cell lysates can be obtained and used for Western blot analysis with an antibody against the target protein to verify the functionality of the shRNA vectors, or RNA can be harvested from transfected cells and used in quantitative RT-PCR to determine the loss of gene expression. If desired, the shRNA plasmids can be re-transformed for unlimited supplies of the plasmids.

Q: Can I select for the plasmid-transfected cells?
A:
Yes. One day after transfection, the cells can be selected with culture media containing 0.5 - 1.0 ug/mL puromycin (Sigma).

Q: How can I create a stable cell line with a functional shRNA expression vector?
A:
Stable cell lines can be generated by two different methods. First, target cells can be transfected with the shRNA plasmid. One day after transfection, the transfected cells can be selected with 0.5 - 1.0 ug/ml puromycin for 1-2 weeks with passages as needed. Alternatively, retroviral packaging cell lines can be used to generate retroviruses for stable cell line generation. For example, the plasmid can be transiently transfected into the Phoenix helper-free amphotropic packaging cells line. Two days after the transfection, the cell culture supernatant is collected, filtered and used to infect the target cell lines. Stable cell lines can be established following drug selection.

Q: What use does the empty vector serve?
A:
For any experiment involving the introduction of foreign DNA into cells, it is important to eliminate any non-specific effects by using an empty vector negative control. The vectors can also be used for cloning your own shRNA construct(s).

Q: What use does the scrambled non-effective plasmid serve?
A:
To specifically rule out the potential non-specific effect induced by expres-sion of the HuSH product, OriGene provides customers with a negative control (TR30012, TR30013 or TR30015), that was constructed by cloning a scrambled sequence cassette (5’ GCACTACCAGAGCTAACTCAGATAGTACT3’) into our pRS, pGFP-V-RS, or pRFP-C-RS vectors respectively. The plasmid should serve as a negative control for gene-specific knockdown experiments and exclude any potential interferon response.

Q: Can you tell me the sequence of your control constructs?
A:
The 29mer sequence used to target firefly luciferase in TR30002 is 5’ GGATTTCAGTCGATGTACACGTTCGTCAC 3’. The 29mer sequence used to target eGFP in TR30001 is 5’ CACAAGCTGGAGTACAACTACAACAGCCA 3’, the 29mer sequence used to target tGFP in TR30009 and TR30016 is 5`GCTACGGCTTCTACCACTTCGGCACCTAC 3`, and the 29mer sequence used to target tRFP in TR30016 is 5’ CTTCAAGACCACATACAGATCCAAGAAAC 3`. The non-effective control sequence is 5’ GCACTACCAGAGCTAACTCAGATAGTACT 3’.

Q: Do I need to use a special strain of E.coli to amplify my HuSH constructs?
A:
Special E.coli are not required for HuSH amplification but we do not recommend using JM109. We routinely use DH5alpha from New England Biolabs.

Q: Are the HuSH plasmids high copy or low copy number?
A:
Although the plasmids technically contain a high-copy number Ori of replication, the hairpin slows replication and thus, we recommend using a low-copy number

Q: Can the pRS, pGFP-V-RS or pRFP-C-RS vectors be packaged by lentivirus?
A:
No, our current RS system is strictly retroviral. However, we are in the process of creating a lentiviral HuSH vector. Please check our website for its release.

Q: Do I have to use retroviral packaging and infection to create stable cell lines?
A:
If your transfection efficiency is very high (e.g. 80% or greater), it is not necessary to use retroviral packaging. Simply split your cells 24hrs. post-transfection and add puromycin (0.5 - 1ug/ml) to the fresh growth medium.

Q: Will 0.5ug/ml-1ug/ml concentration of puromycin work for my cell line?
A:
We strongly recommend that a kill-curve be performed on each batch of cells to ensure that the optimal puromycin concentration is employed.

Q: Which positive control shRNA vector to pick if I purchase shRNA in pGFP-V-RS vector (TG123456)?
A:
HuSH 29-mer Against tGFP in pRS vector is your best choice, cat# TR30009.

Q: What primer should I use to sequence my HuSH plasmids?
A:
It is very difficult to sequence the shRNA constructs due to the hairpin structure. However, you can use DNA relaxation agents in the sequencing reaction (0.83 M Betaine [Sigma #B-0300] plus 1x PCRx Enhancer [in Invitrogen kit part # 11495-017]), which may be helpful. Our sequencing primer is located at the 3' end of the cloning site and has the sequence 5`TTGAGATGCATGCTTTGCATAC3`.

Q: What is the OriGene guarantee on the shRNA expression plasmids?
A:
OriGene guarantees that the sequences in the shRNA expression cassettes are verified to correspond to the target gene with 100% identity. One of the four constructs at minimum are guaranteed to produce 70% or more gene expression knock-down provided a minimum transfection efficiency of 80% is achieved. Western Blot data is recommended over qPCR to evaluate the silencing effect of the shRNA constructs 72 hrs post transfection. To properly assess knockdown, the gene expression level from the included scramble control vector must be used in comparison with the target-specific shRNA transfected samples.

For non-conforming shRNA, requests for replacement product must be made within ninety (90) days from the date of delivery of the shRNA kit. To arrange for a free replacement with newly designed constructs, please contact Technical Services at techsupport@origene.com. Please provide your data indicating the transfection efficiency and measurement of gene expression knockdown compared to the scrambled shRNA control (Western Blot data preferred).

Q: I am writing a paper for publication and need to describe this product. How should I cite?
A:
We recommend that you refer to the product by its specific catalog number and refer to us as OriGene Technologies (Rockville, MD). Furthermore, we'd love to hear from you when your paper is published. Inform us and we will send a gift.

 

Inc 5000 Healthcare Company Copyright © 2014 OriGene Technologies, Inc. All Rights Reserved. Legal Notices.
9620 Medical Center Dr., Suite 200, Rockville, MD 20850 • 1.888.267.4436

Reproduction of any materials from this website is strictly forbidden without permission.

All Products by: Title | Price | Category | Popularity | Best Sellers Topselling Products by: Title | Price | Category | Popularity | Favorites
Popular Categories: Popularity | Our Choices | All-Round Favorites | Title Topselling Categories: Popularity | Our Choices | All-Round Favorites | Title