OriGene Technologies, Inc.
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home Support FAQs CRISPR/CAS9 FAQs

CRISPR/CAS9 FAQs

1. Q: A 20bp target sequence is needed with a NGG PAM seq. Shall the NGG be exactly immediately following the 3' of this 20bp sequence?
A: Yes, the NGG is located immediately next to the 3' end of the 20bp sequence
2. Q: How to design the 20bp target-specific sequence?
A: The 20bp target-specific sequence should precede NGG (PAM). Please BLAST the seed region (14bp PAM-proximal) of the 20bp target sequence to make sure it’s unique along the genome to guarantee specificity.
3. Q: How to avoid off target issue using CRISPR/Cas?
A: You can blast your target sequences. If the off-target sequences don’t have the PAM (NGG), then they won’t be targeted by CRISPR/Cas9. You also want to choose target sequences with mismatches in the 8-14 bp at the 3’ end of the target sequences. This way, the off-target issue can be decreased dramatically. For therapeutic purpose, you can use Cas9 nickase which only cuts one strand.
4. Q: How many target RNA sequences should I use for a genome editing project?
A: Due to the un-predicable nature of gRNA, we recommend 2 and more gRNA targeting sequences to be designed to make sure that at least one will lead to efficient cleavage.
5. Q: Do you know the specific cleavage site of the Cas9:gRNA complex in terms of where in the targeting sequence the cleaving occurs?
A: Cas9 cleaves at 3 bp away from the 3’ end of the target sequence in the genome.
6. Q: why do you need T7-driven vector to express gRNA and cas-9?
A: For making gene knockout mice and genome editing in other organisms, such as Drosophila, some researchers do microinjection of gRNA and Cas9 mRNA into cells.
7. Q: Both of the guide and donor plasmids need to be transfected into cells; So transfection may be a limiting factor.
A: You can find a good transfection reagent for your cells. For hard to transfect cells, many researchers use electroporation. You can also try our Magnetofection or Viromers that are good for hard to transfect cells: http://www.origene.com/cdna/transfection.mspx The GFP expression in pCas-Guide-EF1a-GFP can be used to monitor transfection efficiency and to sort out transfected GFP positive cells.
8. Q: The transfection efficiency of my cell line is only 20%, how to enrich CRISPR transfected cells?
A: You can use pCas-Guide-EF1a-GFP to sort out transfected GFP cells since GFP is also expressed. We also have a pCas-Guide-EF1a-CD4 vector, you can use CD4 antibody beads to enrich transfected cells.
9. Q: For knocking out a target gene, a donor plasmid is not needed, correct?
A: Without donor template DNA, the double stranded break will be repaired by NHEJ; unpredicted indels will be introduced. You will screen the deletions/insertions that cause frame shift. With donor DNAs, you will get desired insertion/ deletion/ mutations.
10. Q: How long should the LHA and RHA be?
A: 600-1000 bp left or right homologous arms should work for HDR mediated repair vis CRISPR.
11. Q: How to knockout all the splicing variants of a gene using OriGene’s pre-designed donor vectors, eg. OriGene’s CRISPR knockout / knockin kit?
A: Different splice variants of a gene are generated from the same pre-mRNA, spliced differently. When we design target sequences to knockout all the splicing forms of a gene, the target sequences are located around the start codon, ATG, of the longest splice variant. The 3’ end of the left homologous arm in the donor vector is right upstream of the start codon ATG. After homologous recombination, the GFP-puro cassette replaces part of the coding region of the longest splice variant in the genome. At the 3’ end of the GFP-puro functional cassette, there is a transcriptional stop signal; therefore the rest of the target gene will not be transcribed.
12. Q: Is there a method for cloning knockout cell lines from the engineered pool of cells?
A: Isolate individual cell colonies.
13. Q: Do you need to linearize the donor template before transfecting into cells for efficient repair?
A: The donor template DNA is not preferred to be linearized as this will increase random integration.
14. Q: How to select for positive clones if using long oligos as a donor template?
A: Isolate single cell colonies, do WB (for gene knockout or tagging) or genomic PCR and sequencing (for mutations).
15. Q: How to screen the edited cells after transfecting the CRISPR/Cas9 vector?
A: If it is gene knockout, you can do WB to verify it. You can also do genomic PCR to detect the genomic integration. For mutations, you can amplify the genomic sequence, and sequence it. If you do gene knockout, the selection marker in the donor template DNA will help the selection. If it is necessary, you can isolate individual cell colonies for introduction of specific mutations in the genome and other applications.
16. Q: Does Crispr/Cas system work for non-dividing cells?
A: NHEJ repair works in non-dividing cells; HDR is not active in non-dividing cells. Therefore, you can do gene disruption using CRISPR/Cas9 system without donor template DNA.
17. Q: Using CRISPR, can you get monoallelic knockout or biallelic knockout?
A: CRISPR/Cas9 double-strand cleavage is very efficient. If just using CRISPR/Cas9 vectors to introduce indels, if transfection efficiency is high, more biallelic knockout can occur. In the presence of donor DNA, since homologous recombination may be a limiting factor, some cells contain monoallelic knockout and some cells contain biallelic knock out.
18. Q: Do I get monoallelic knock-out or biallelic knock-out using the knock-out kit via CRISPR? What do I need to do to get biallelic knock-out?
A: If you isolate single cell colonies, in some cells gene knock-out may occur only in one allele; in some cells gene knock-out may occur in both alleles. If you only have single allele knockout and you want to get both-allele knockout, you can order another donor vector containing a different mammalian selection marker, such as blastocidin or neomycin resistant marker. OriGene has both functional cassettes. You can do the knockout procedure again with the new donor vector to target the second allele (one allele is already targeted and replaced with GFP-puro cassette). Alternatively, you can use Cre to flox out the puro cassette from your edited cells and use the same donor vector from the knockout kit and do the knockout again to target the second allele.
19. Q: Do you have the cas9 antibody?
A: We do have Cas9 antibody (cat# TA190309). In our CRISPR/Cas9 vectors, Cas9 has a C-terminal Myc-DDK tag. DDK is the same as Flag. You can try OriGene’s anti-DDK antibody (SKU TA50011-100)
20. Q: If I want to use CRISPR/Cas9 to knock down a certain gene, what kind of negative control should I use?
A: You can use a scramble control, pCas-Scramble, SKU GE100003, or pCas-Scramble-EF1a-GFP, SKU GE100021.
21. Q: For gene targeting in mice, do you recommend transfecting ES cells or pronuclei?
A: You can do both. You can inject mRNA (gRNA and Cas9 mRNA) or plasmid DNA (target sequence cloned pCas-Guide) into the zygotes or ES cells
22. Q: What is the limit to multiple gene disruption?
A: You can do multiplexes using CRISPR/Cas9 system. You can co-transfect or co-inject several guide RNAs into your cells; so you will achieve multiple gene disruption or genome editing. The limit could be transfection efficiency.
23. Q: How do you make sure that Cas9 will not integrate in genome if you use lentivector?
A: For screening purpose, for short term, integration of Cas9 into the genome for 2 weeks does not affect cells. There is also a non-integration lenti packaging kit commercially available from Clontech that the lenti vector won’t be integrated after transduction.
24. Q: Can you introduce mutations anywhere in the genome, including promoters or enhancers?
A: Yes. The 20 bp target sequences only need to precede NGG.
25. Q: Do you see variability in success with different cell lines?
A: Yes, depending on the cell line and target sequences.
26. Q: For fluorescently labeling (tagging) a gene of interest, is it necessary to culture transfected cells to dilute cells containing donor DNA?
A: If in the donor construct the fluorescent protein does not have a mammalian expression promoter (for example the left homologous arm does not contain the promoter) , then you can sort the fluorescent cells out (you can tell in donor DNA only transfected cells); you might not need to get individual cell colonies. If the fluorescent protein in the donor template DNA does contain a mammalian expression promoter, you will need to pass the transfected cells several generations to dilute cells containing the donor construct.
27. Q: What is the known efficiency relative to other genome editing approaches?
A: In general, the genome editing efficiency of CRISPR/Cas9 is similar or higher than TALEN. However, CRISPR/Cas9 is much more simple and easy to do. You will need to engineer the protein to recognize new DNA sequence in TALEN system, while CRISPR/Cas9 is RNA based.
28. Q: What is the sequence of CF3 sequencing primer?
A: 5’-ACGATACAAGGCTGTTAGAGAG-3’
29. Q: What is your validation data for your pCas-Guide system?
A: Please see the downloadable validation data at www.origene.com/Cas9
30. Q: What is the scrambled sequence in pCas-Scramble and pCas-Scramble-EF1a-GFP?
A: 5’ GCACTACCAGAGCTAACTCA 3’
31. Q: Do you provide gRNA cloning service and donor vector service?
A: Yes, you can order donor vector sercie via OriGene’s gene synthesis branch, Blue Heron: http://www.blueheronbio.com/Services/Genome-Editing.aspx . gRNA cloning service can be ordered via both OriGene site and Blue Heron.
32. Q: Is there any safety issue with this pLenti vector?
A: The pLenti vector is a third generation lentiviral vector and it is the safest lenti-viral vector because both LTRs are truncated. Please contact the biosafety office at your institution prior to use of the pLenti vector for permission and for further institution-specific instructions. BL2/(+) conditions should be used at all times when handling lentivirus. All decontamination steps should be performed using 70% ethanol/1% SDS. Gloves should be worn at all times when handling lentiviral preparations, transfected cells or the combined transfection reagent and lentiviral DNA.
33. Q: What is unique about the 3rd generation of Lentiviral vectors?
A: The 3rd generation lentiviral vectors are safer than the 2nd generation vectors. The 3rd generation packaging systems express gag and pol from one packaging vector and rev from another. The 3rd generation packaging systems DO NOT express tat (Trans-Activator of Transcription).
34. Q: Can I use a second generation packaging system with the pLenti vectors?
A: Yes, a second generation packaging system should work with OriGene’s third generation pLenti vectors although we have not explicitly tested this. You can use OriGene’s high efficient third generation lenti-packaging kit (cat# TR30002) for pLenti-vectors.
35. Q: How can I sequence the target sequenced cloned in pT7-Guide vector?
A: M13 forward primer, 5’ CGCCAGGGTTTTCCCAGTCACGAC 3’

 

liner
Inc 5000 Healthcare Company Copyright © 2014 OriGene Technologies, Inc. All Rights Reserved. Legal Notices.
9620 Medical Center Dr., Suite 200, Rockville, MD 20850 • 1.888.267.4436

Reproduction of any materials from this website is strictly forbidden without permission.

All Products by: Title | Price | Category | Popularity | Best Sellers Topselling Products by: Title | Price | Category | Popularity | Favorites
Popular Categories: Popularity | Our Choices | All-Round Favorites | Title Topselling Categories: Popularity | Our Choices | All-Round Favorites | Title