OriGene Technologies, Inc.
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home Support FAQs pCAS-Guide FAQs

pCAS-Guide FAQs

1. Q: a 20bp target sequence is needed with a NGG PAM seq. Shall the NGG be exactly immediately following the 3' of this 20bp sequence
A: Yes the NGG is located immediately next to the 3' end of the 20bp sequence.
2. Q: How to design the 20bp target-specific sequence?
A: The 20bp target-specific sequence should proceed NGG (PAM). Please BLAST the seed region (12bp PAM-proximal) of the 20bp target sequence to make sure it’s unique along the genome to guarantee specificity. Seed-region , 5’-NNNNNNNNNNNN-NGG-3’, is specific to the relevant genome. Do not selection the sequence has less than 3bp mismatch at the seed region and follows with NGG or NAG.
3. Q: How many target RNA sequence should I use for a genome editing project?
A: Due to un-predicable nature of gRNA, we recommend 2 and more gRNA targeting sequences to be designed to make sure that at least you will have one targeting sequence that works.
4. Q: How to analyze genome editing if the donor sequence does not have a fluorescence protein marker or antibiotic selection marker?
A: You can use WB if the gene encodes a protein that can be distinguished from the endogenous protein. You can also use junction PCR to detect the donor sequence, one primer in the donor sequence and one primer in the region downstream of the donor sequence.
5. Q: How to address the off-target effect of pCas9 system?
A: When designing the target sequence, make sure to blast the sequence that there is no matching sequences containing less than 3 mismatches proximal PAM. The other sequences should not preceeds NGG or NAG.
6. Q: What is the sequence of CF3 sequencing primer?
A: 5’-ACGATACAAGGCTGTTAGAGAG-3’
7. Q: What is your validation data for your pCas-Guide system?
A: Please see the validation data at www.origene.com/Cas9.
8. Q: What is the scrambled sequence in pCas-Scramble?
A: 5’ GCACTACCAGAGCTAACTCA 3’
9. Q: Do you provide gRNA cloning service and donor vector service?
A: Yes, you can order them through OriGene’s gene synthesis company, http://www.blueheronbio.com/Services/Genome-Editing.aspx

 

liner
Inc 5000 Healthcare Company Copyright © 2014 OriGene Technologies, Inc. All Rights Reserved. Legal Notices.
9620 Medical Center Dr., Suite 200, Rockville, MD 20850 • 1.888.267.4436

Reproduction of any materials from this website is strictly forbidden without permission.

All Products by: Title | Price | Category | Popularity | Best Sellers Topselling Products by: Title | Price | Category | Popularity | Favorites
Popular Categories: Popularity | Our Choices | All-Round Favorites | Title Topselling Categories: Popularity | Our Choices | All-Round Favorites | Title