OriGene Technologies, Inc.
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home Support FAQs TrueORF Clones/PrecisionShuttle FAQs

TrueORF Clones/PrecisionShuttle FAQs

1. Q: What is the PrecisionShuttle System?
A: The PrecisionShuttle System provides a restriction-enzyme-based ap¼proach to append different tags to oneÆs open reading frame (ORF) of interest.
2. Q: What is the difference between OriGeneÆs Entry vector and the destination vectors?
A: The major differences are the antibiotic selection marker and the epitope tags. The Entry vector carries kanamycin resistance (25 ug/ml), while all destina¼tion vectors contain the ampicillin resistance gene (100 ug/ml). This allows simple screening for successful subcloning products. All of the vectors have a unique combination of N- and C-terminal epitope tags or a fluorescent marker, as de¼scribed in Table I.
3. Q: What are the functional aspects of the pCMV6-AC-GFP vector?
A: Like all OriGene vectors, the CMV promoter drives the heterologous expression of the specified open reading frame (ORF) which is in-frame with Turbo Green Fluorescent Protein (tGFP) on the C-terminus. tGFP expression permits the positive identification of mammalian cells transfected with plasmid. The neomycin resistance gene is also expressed downstream of the SV40 promoter within the same vector and permits positive selection of transfected cells as well as stable cell line production. For bacterial amplification, the ampicillin resistance gene is engineered on the opposite strand.
4. Q: OriGeneÆs GFP is listed as TurboGFP. How is this different from other available GFPs?
A: TurboGFP is a fully licensed, 26kDA protein product from Evrogen JSC 17 that works well in standardized GFP assays. Excitation max is 482nm and emis¼sion max is 502nm. It yields 112% of the brightness compared to eGFP and has no known cellular toxicity. It is an isoform of the naturally occurring protein from Pontellina plumata that has been optimized for rapid labeling of cells/organelles and tracking of promoter activity. It is a perfect choice for monitoring transient protein expression.
5. Q: Has OriGene fully sequenced all TrueORF clones?
A: Not always. When transferring the cDNA into the TrueORF Entry Vector, OriGene always uses fully sequenced plasmids as templates and Phusion High-Fi¼delity DNA Polymerase (New England Biolabs), which has a mutation rate less than 4 x 10-7. This ensures the highest fidelity of every TrueORF clone. After cloning into the Entry vector, each of OriGeneÆs TrueORF clones was sequenced at both the 5Æ and 3Æ ends, and the resulting sequence was matched to the corresponding reference sequence. For ORFs of 1 Kb or less in length, the 5Æ and 3Æ sequencing reads have covered the full ORF. For longer cDNAs, the ORF was not fully covered by sequencing reads.
6. Q: Do TrueORF clones exactly match the reference gene sequence?
A: All TrueORF clones are guaranteed to match the corresponding ORF sequence posted on our website. However, some clones may contain nucleotide changes compared to the published reference sequences. This is due to SNPs (single nucleotide polymorphisms) reflecting the unique differences from genes expressed in different tissues and different individuals. Published references may represent a different SNP than the OriGene transcript. Should a specific SNP be required, this can be obtained via our Gene Synthesis service.
7. Q: Sequences of the sequencing primers, VP1.5, XL39, pTUNE-F Forward and pTUNE-R Reverse
A: VP1.5 (forward seq primer)
5Æ GGACTTTCCAAAATGTCG 3Æ Tm=51C
XL39 (reverse seq primer)
5Æ ATTAGGACAAGGCTGGTGGG 3Æ Tm=60C
pTUNE-F Forward
5Æ TAGAGTCGACCTGCAGCCGG 3Æ Tm=58C
pTUNE-R Reverse
5Æ TCGCTGATTTGTGTAGGGGA 3Æ Tm=52C
8. Q: What bacterial competent cells should I use for pTune transformation?
A: Due to the tendency of the LacO elements to recombine in standard laboratory E. Coli stains, please transform the pTune vector in a rearrangement-deficient bacterial strain, such as Sure 2 Supercompetent cells from Stratagene or Stbl4 from Invitrogen.
9. Q: Can I transfer large ORFs using this system?
A: It has been reported that ORFs larger than 4 Kb are unstable in recombi¼nation-based systems; conversely, our restriction digest-based vector system has no real size limitation. An ORF up to 18 Kb can be readily transferred from one vector to another.
10. Q: What restriction enzymes should I use if Sgf I or Mlu I sites are present in my ORF?
A: While 96% of all human and mouse ORFs can use the Sgf I - Mlu I com¼bination, some ORFs do contain internal Mlu I site(s). Most of those ORFs with an internal Mlu I site can be transferred using another rare cutter (Rsr II), whose re¼striction site is upstream of Mlu I, or Not I, whose site is immediately downstream of Mlu I. Using one of the four different subcloning combinations, any ORF can be transferred from one vector to another. The recommended subcloning combina¼tion for every TrueORF cDNA is listed in the product information on our website.
11. Q: Why does my Certificate of Authorization (COA) indicate cloning sites other than Sgf I and Mlu I?
A: Whenever one or both of these sites is present within the ORF of the tran¼script, the PrecisionShuttle vectors share other sites engineered to accommodate this, e.g. Rsr II or Asc I.
12. Q: What sites should I use to transfer a TrueORF clone into the Gateway system?
A: There are multiple sites in pCMV6-Entry than can be used to move the insert of a TrueORF clone into one of GatewayÆs Entry vectors (pENTR-1A, -2B, -3C, -4, and -11). These sites are EcoRI, Sal I, BamHI and Kpn I at the 5Æ end, and Not I at the 3Æ end.
13. Q: What restriction sites are available for subcloning into other vectors?
A: The vector map and nucleotide sequence can be found at http://www.origene.com/cdna/trueorf/destinationvector.aspx
14. Q: How many amino acids are present in the linker between my protein and tGFP?
A: To accommodate the Mlu I cloning site, which maintains the proper read¼ing frame, this vector appends a threonine and arginine. This is far fewer than with other recombination-based shuttling systems.
15. Q: Which vector serves the negative control for the GFP fusion clone?
A: We recommend pCMV6-AN-GFP (Cat# PS100019).
16. Q: Can I purchase the empty Entry vector without any open reading frame?
A: Yes, The catalog number is PS100001 for a lyophilized 10 ug aliquot. Alternatively, you can release the ORF from the Entry vector with Xho I and Sal I, and then religate to create the empty Entry vector control.
17. Q: I cannot detect any protein expression from the TrueORF clone in a pCMV6-Entry vector. What are my options?
A: 1) Check your transfection efficiency. We recommend using a plasmid that expresses a fluorescent marker (pCMV6-AN-GFP PS100019). 2) Anti-FLAG antibodies from other vendors are not as sensitive as OriGene’s optimized 4C5-Anti-DDK antibody (TA50011) when directed at the same epitope.
18. Q: What does your disclaimer mean?
A: OriGeneÆs disclaimer for the TrueORF clones reads as follows: ôOur mo¼lecular clone sequence data has been matched to the accession number below as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding accession number, e.g., by representing an alternative RNA splicing form or single nucleotide polymor-phism (SNP).ö The NCBI RefSeq mRNA sequences are continuously being revised, as some may have been derived from aberrantly spliced transcripts or generated by incorrect prediction of intron-exon junctions in silico. These sequences are therefore used only as a ôreferenceö and not as a ôstandardö. OriGeneÆs clones are isolated from full-length cDNA libraries and may differ from the reference sequence for this reason.
19. Q: What is the TrueORF Guarantee?
A: OriGene warrants that the product will meet specifications listed. At OriGeneÆs discretion, free replacement of any non-conforming product will be made if OriGene is notified within 30 days of product receipt. If you experience any difficulty with any OriGene product, please contact our Technical Support Staff at 888-267-4436, or 301-340-3188 outside the US.
20. Q: I need to cite your product for a paper I am writing. What language should I use?
A: We recommend that you refer to the product by its specific catalog number and refer to us as OriGene Technologies (Rockville, MD). Furthermore, we'd love to hear from you when your paper is published. Inform us and we will send a gift.
21. Q: How can I improve the efficiency of my SgfI digestion?
A: We have heard that there can be lot-to-lot variations of the commercially available SgfI enzyme. Several of our scientists have begun to use the "FastDigest« AsiSI (SfaAI) " enzyme (Fermentas) that has the same recognition sequence. In our hands the double digestions with MluI are complete in a shorter time using this enzyme compared to some but not all SgfI batches.
22. Q: How do you transfer the ORF insert I purchased into another tagging vector?
A: Over 70 destination vectors are designed with compatible MCS for easy shuttling of TrueORF inserts. This can be performed easily using a specific pair of restriction enzymes to cut-and-ligate subclone into the desired destination vector. OriGene simplifies this process by offering the RapidShuttling Kit (see http://www.origene.com/rapid-shuttling-kit). OriGene also provides a custom cloning service available through our website.
23. Q: I cannot see any green fluorescence with the TrueORF clone in a pCMV6-AC-GFP vector. What are my options?
A: Your protein of interest might quench the fluorescence of tGFP. To confirm, we suggest you first run a Western Blot with a protein specific antibody or anti-tGFP. The molecular weight of the tGFP fusion protein is approximately 26 kDa larger than the endogenous protein. We recommend OriGene’s Anti-tGFP antibody (part number TA50041). Antibodies against other GFPs will not recognize tGFP
24. Q: Is there any safety issue with this pLenti vector?
A: The pLenti vector is a third generation lentiviral vector and it is the safest lenti-viral vector because both LTRs are truncated. Please contact the biosafety office at your institution prior to use of the pLenti vector for permission and for further institution-specific instructions. BL2/(+) conditions should be used at all times when handling lentivirus. All decontamination steps should be performed using 70% ethanol/1% SDS. Gloves should be worn at all times when handling lentiviral preparations, transfected cells or the combined transfection reagent and lentiviral DNA
25. Q: What is unique about the 3rd generation of Lentiviral vectors?
A: The 3rd generation lentiviral vectors are safer than the 2nd generation vectors. The 3rd generation packaging systems express gag and pol from one packaging vector and rev from another. The 3rd generation packaging systems DO NOT express tat (Trans-Activator of Transcription).
26. Q: What cell line should be used in order to produce lentivirus?
A: HEK293T cells are commonly used to produce lentivirus. The HEK293T cell line for producing lentiviral particles can be obtained from ATCC.
27. Q: How do I propagate the pLenti vector in E. coli?
A: The lenti-viral vector can be amplified using high-efficiency, competent E. coli cells (= 1×108 CFU/µg DNA) following the manufacturer’s transformation protocol. Plate the transformants on LB-agar plates supplemented with 34 µg/ml chloramphenicol.
28. Q: Can I use the pLenti vector for stable selection in mammalian cells?
A: Only a subset of the pLenti vectors have mammalian selectable markers and those without a mammalian selection marker cannot be used for mammalian selection. You can make stable cell lines using the pLenti-C-Myc-DDK-IRES-Puro vector. You might also be able to get stable cells by GFP sorting using the pLenti-C-Myc-DDK-IRES-GFP vector.
29. Q: How do I clone an insert into the pLenti vector?
A: The multiple-cloning site of the pLenti vector is compatible with OriGene’s PrecisionShuttling system, a simple cut-and-ligation process. Please refer to the corresponding protocols in the TrueORF application guide.
30. Q: What is the size limit for the ORF that is to be cloned into the pLenti vector?
A: In general, lentiviral vectors have the capacity to accommodate an insert of 9 kb. However, ORFs larger than 4kb will dramatically decrease the packaging efficiency.
31. Q: Can pLenti vectors be used in direct transfections as opposed to making virus?
A: OriGene’s pLenti vectors can also be used in transient transfections to achieve expression of the transgene. This usually involves lower levels of protein production due to diminished transfection efficiency.
32. Q: What is the difference between a lentivirus and a retrovirus?
A: Lenti viruses are a subtype of retrovirus. The main difference between lentiviruses and standard retroviruses from an experimental standpoint is lentiviruses are capable of infecting both non-dividing and actively dividing cell types whereas standard retroviruses can only infect mitotically active cell types. Both lentiviruses and standard retroviruses use the gag, pol, and env genes for packaging. However, the isoforms of these proteins used by retroviruses and lentiviruses are different and lentiviral vectors may not be efficiently packaged by each other’s packaging systems.
33. Q: Can I use a second generation packaging system with the pLenti vectors?
A: Yes, a second generation packaging system should work with OriGene’s third generation pLenti vectors although we have not explicitly tested this. You can use OriGene’s third generation packaging kit, cat# TR30002 for pLenti-vectors.

 

liner
Inc 5000 Healthcare Company Copyright © 2014 OriGene Technologies, Inc. All Rights Reserved. Legal Notices.
9620 Medical Center Dr., Suite 200, Rockville, MD 20850 • 1.888.267.4436

Reproduction of any materials from this website is strictly forbidden without permission.

All Products by: Title | Price | Category | Popularity | Best Sellers Topselling Products by: Title | Price | Category | Popularity | Favorites
Popular Categories: Popularity | Our Choices | All-Round Favorites | Title Topselling Categories: Popularity | Our Choices | All-Round Favorites | Title