MAX binding protein (MNT) (NM_020310) Human Untagged Clone

CAT#: SC304735

MNT (untagged)-Human MAX binding protein (MNT)


  "NM_020310" in other vectors (4)

Reconstitution Protocol

USD 814.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
Rabbit Polyclonal Anti-MNT Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "MAX binding protein"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MAX binding protein
Synonyms bHLHd3; lncRNA-HAL; MAD6; MXD6; ROX
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC304735 sequence for NM_020310 edited (data generated by NextGen Sequencing)


ATGAGCATAGAGACGCTACTGGAGGCGGCCCGCTTCCTGGAATGGCAAGCGCAGCAACAACAGAGAGCAC
GTGAGGAGCAGGAGCGGCTTCGCTTGGAGCAGGAGCGAGAGCAGGAACAGAAGAAGGCCAATAGCCTGGC
CAGGCTGGCACATACCCTTCCTGTGGAGGAACCCCGCATGGAGGCGCCACCCCTGCCTCTGTCTCCACCG
GCTCCCCCGCCGGCACCCCCACCACCACTTGCCACCCCTGCCCCACTGACTGTCATCCCTATCCCTGTGG
TGACCAACTCCCCTCAGCCTCTACCCCCACCCCCACCCTTGCCCGCGGCAGCCCAGCCTCTGCCCCTGGC
GCCTCGTCAGCCGGCCCTGGTTGGCGCCCCCGGACTCAGCATTAAGGAGCCTGCCCCCCTGCCCAGCAGG
CCGCAGGTGCCCACCCCTGCTCCCCTACTGCCGGACTCGAAGGCCACCATTCCACCCAATGGCAGCCCCA
AGCCTTTGCAGCCCCTCCCCACGCCTGTCCTGACCATAGCGCCACACCCTGGAGTCCAGCCTCAGCTGGC
CCCCCAGCAGCCGCCCCCACCCACGCTGGGGACCCTGAAGTTGGCACCAGCTGAAGAAGTCAAATCCAGT
GAACAGAAGAAGAGGCCCGGGGGGATCGGAACCAGAGAAGTCCACAACAAATTGGAGAAGAACAGGAGGG
CCCATCTGAAAGAGTGCTTTGAGACCCTGAAGCGGAACATCCCCAACGTGGATGACAAGAAGACGTCCAA
TCTGAGCGTGCTGCGGACGGCGCTGCGGTACATCCAGTCCCTGAAGAGGAAGGAGAAGGAATATGAGCAT
GAAATGGAGCGGCTGGCACGTGAGAAGATTGCCACGCAGCAGCGGCTGGCAGAGCTCAAGCACGAGCTGA
GCCAGTGGATGGACGTACTGGAGATTGACCGCGTGCTGCGGCAGACGGGCCAGCCCGAGGATGACCAGGC
CTCCACCTCCACCGCCTCTGAGGGTGAGGACAACATAGACGAGGATATGGAGGAGGACCGGGCGGGCCTG
GGCCCACCTAAGCTGAGCCATCGTCCCCAGCCGGAGCTGCTGAAGTCCACCCTGCCACCCCCCAGCACCA
CCCCTGCGCCTCTGCCTCCACACCCACACCCTCACCCCCACTCCGTGGCCCTACCTCCTGCCCACCTCCC
CGTGCAGCAGCAGCAGCCACAGCAGAAGACCCCTCTGCCAGCCCCTCCTCCCCCACCGGCTGCCCCTGCC
CAGACACTGGTGCCAGCTCCAGCCCATCTGGTGGCGACGGCTGGGGGTGGCTCCACGGTCATCGCCCACA
CAGCCACCACTCACGCTTCAGTCATCCAGACTGTGAACCACGTTCTGCAGGGGCCAGGCGGCAAGCACAT
CGCCCACATCGCCCCCTCGGCCCCCAGCCCTGCGGTGCAACTGGCGCCTGCCACACCCCCCATTGGGCAC
ATCACTGTGCACCCTGCCACCCTCAACCATGTGGCCCACCTGGGCTCCCAGCTGCCCTTGTACCCGCAGC
CCGTGGCAGTGAGCCACATCGCCCACACCCTCTCGCACCAGCAAGTCAACGGCACGGCCGGCCTGGGGCC
CCCGGCTACTGTCATGGCAAAGCCGGCCGTGGGGGCTCAGGTGGTGCACCACCCCCAGCTGGTGGGCCAG
ACCGTGCTCAACCCTGTGACCATGGTCACCATGCCCTCCTTCCCAGTCAGCACACTCAAGCTGGCTTGA


Clone variation with respect to NM_020310.2
Restriction Sites Please inquire     
ACCN NM_020310
Insert Size 4500 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_020310.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_020310.2, NP_064706.1
RefSeq Size 4865 bp
RefSeq ORF 1749 bp
Locus ID 4335
UniProt ID Q99583
Cytogenetics 17p13.3
Gene Summary The Myc/Max/Mad network comprises a group of transcription factors that co-interact to regulate gene-specific transcriptional activation or repression. This gene encodes a protein member of the Myc/Max/Mad network. This protein has a basic-Helix-Loop-Helix-zipper domain (bHLHzip) with which it binds the canonical DNA sequence CANNTG, known as the E box, following heterodimerization with Max proteins. This protein is likely a transcriptional repressor and an antagonist of Myc-dependent transcriptional activation and cell growth. This protein represses transcription by binding to DNA binding proteins at its N-terminal Sin3-interaction domain. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.