Estrogen Receptor 1 (ESR1) (NM_000125) Human Untagged Clone

CAT#: SC125287

ESR1 (untagged)-Human estrogen receptor 1 (ESR1), transcript variant 1


  "NM_000125" in other vectors (6)

Reconstitution Protocol

USD 832.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
ESR1 (Estrogen Receptor 1/ER) mouse monoclonal antibody, clone OTI1B1 (formerly 1B1)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Estrogen Receptor 1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Estrogen Receptor 1
Synonyms ER; Era; ESR; ESRA; ESTRR; NR3A1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC125287 sequence for NM_000125 edited (data generated by NextGen Sequencing)
ATGACCATGACCCTCCACACCAAAGCATCTGGGATGGCCCTACTGCATCAGATCCAAGGG
AACGAGCTGGAGCCCCTGAACCGTCCGCAGCTCAAGATCCCCCTGGAGCGGCCCCTGGGC
GAGGTGTACCTGGACAGCAGCAAGCCCGCCGTGTACAACTACCCCGAGGGCGCCGCCTAC
GAGTTCAACGCCGCGGCCGCCGCCAACGCGCAGGTCTACGGTCAGACCGGCCTCCCCTAC
GGCCCCGGGTCTGAGGCTGCGGCGTTCGGCTCCAACGGCCTGGGGGGTTTCCCCCCACTC
AACAGCGTGTCTCCGAGCCCGCTGATGCTACTGCACCCGCCGCCGCAGCTGTCGCCTTTC
CTGCAGCCCCACGGCCAGCAGGTGCCCTACTACCTGGAGAACGAGCCCAGCGGCTACACG
GTGCGCGAGGCCGGCCCGCCGGCATTCTACAGGCCAAATTCAGATAATCGACGCCAGGGT
GGCAGAGAAAGATTGGCCAGTACCAATGACAAGGGAAGTATGGCTATGGAATCTGCCAAG
GAGACTCGCTACTGTGCAGTGTGCAATGACTATGCTTCAGGCTACCATTATGGAGTCTGG
TCCTGTGAGGGCTGCAAGGCCTTCTTCAAGAGAAGTATTCAAGGACATAACGACTATATG
TGTCCAGCCACCAACCAGTGCACCATTGATAAAAACAGGAGGAAGAGCTGCCAGGCCTGC
CGGCTCCGCAAATGCTACGAAGTGGGAATGATGAAAGGTGGGATACGAAAAGACCGAAGA
GGAGGGAGAATGTTGAAACACAAGCGCCAGAGAGATGATGGGGAGGGCAGGGGTGAAGTG
GGGTCTGCTGGAGACATGAGAGCTGCCAACCTTTGGCCAAGCCCGCTCATGATCAAACGC
TCTAAGAAGAACAGCCTGGCCTTGTCCCTGACGGCCGACCAGATGGTCAGTGCCTTGTTG
GATGCTGAGCCCCCGATACTCTATTCCGAGTATGATCCTACCAGACCCTTCAGTGAAGCT
TCGATGATGGGCTTACTGACCAACCTGGCAGACAGGGAGCTGGTTCACATGATCAACTGG
GCGAAGAGGGTGCCAGGCTTTGTGGATTTGACCCTCCATGATCAGGTCCACCTTCTAGAA
TGTGCCTGGCTAGAGATCCTGATGATTGGTCTCGTCTGGCGCTCCATGGAGCACCCAGTG
AAGCTACTGTTTGCTCCTAACTTGCTCTTGGACAGGAACCAGGGAAAATGTGTAGAGGGC
ATGGTGGAGATCTTCGACATGCTGCTGGCTACATCATCTCGGTTCCGCATGATGAATCTG
CAGGGAGAGGAGTTTGTGTGCCTCAAATCTATTATTTTGCTTAATTCTGGAGTGTACACA
TTTCTGTCCAGCACCCTGAAGTCTCTGGAAGAGAAGGACCATATCCACCGAGTCCTGGAC
AAGATCACAGACACTTTGATCCACCTGATGGCCAAGGCAGGCCTGACCCTGCAGCAGCAG
CACCAGCGGCTGGCCCAGCTCCTCCTCATCCTCTCCCACATCAGGCACATGAGTAACAAA
GGCATGGAGCATCTGTACAGCATGAAGTGCAAGAACGTGGTGCCCCTCTATGACCTGCTG
CTGGAGATGCTGGACGCCCACCGCCTACATGCGCCCACTAGCCGTGGAGGGGCATCCGTG
GAGGAGACGGACCAAAGCCACTTGGCCACTGCGGGCTCTACTTCATCGCATTCCTTGCAA
AAGTATTACATCACGGGGGAGGCAGAGGGTTTCCCTGCCACGGTCTGA

Clone variation with respect to NM_000125.3
975 c=>g;1199 g=>t
Restriction Sites Please inquire     
ACCN NM_000125
Insert Size 3500 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000125.2, NP_000116.2
RefSeq Size 6456 bp
RefSeq ORF 1788 bp
Locus ID 2099
UniProt ID P03372
Cytogenetics 6q25.1-q25.2
Domains HOLI, Oest_recep, zf-C4
Protein Families Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
Gene Summary This gene encodes an estrogen receptor and ligand-activated transcription factor. The canonical protein contains an N-terminal ligand-independent transactivation domain, a central DNA binding domain, a hinge domain, and a C-terminal ligand-dependent transactivation domain. The protein localizes to the nucleus where it may form either a homodimer or a heterodimer with estrogen receptor 2. The protein encoded by this gene regulates the transcription of many estrogen-inducible genes that play a role in growth, metabolism, sexual development, gestation, and other reproductive functions and is expressed in many non-reproductive tissues. The receptor encoded by this gene plays a key role in breast cancer, endometrial cancer, and osteoporosis. This gene is reported to have dozens of transcript variants due to the use of alternate promoters and alternative splicing, however, the full-length nature of many of these variants remain uncertain. [provided by RefSeq, Jul 2020]
Transcript Variant: This variant (1) uses the most proximal promoter, and encodes isoform 1. Variants 1-4 all encode the same isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.