OriGene Technologies, Inc.
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
Home cDNA Clone Gene Synthesis

Custom Request form for Clone Modification

* OriGene Clone To Be Modified:
Modification Needed
Example #1: Mutate nucleotide position 359 G to T, resulting in an alanine into threonine substitution in codon 87 (A87T). Subclone the mutated insert into PS100019 for N-teminus GFP tagging.

Example #2: Subclone the indicated sequence from the parental clone into PS100031 vector for domain expression. ATGGTGGCCCGGTTAAGGGCTCGGTAGCTCTGTAGCTGGAGCTGAG
* Plasmid Needed (µg)
* First Name
* Last Name
* Email Address
* Institution Name
* Country
* Phone
* is required field
Inc 5000 Healthcare Company Copyright © 2015 OriGene Technologies, Inc. All Rights Reserved. Legal Notices.
9620 Medical Center Dr., Suite 200, Rockville, MD 20850 • 1.888.267.4436

Reproduction of any materials from this website is strictly forbidden without permission.

All Products by: Title | Price | Category | Popularity | Best Sellers Topselling Products by: Title | Price | Category | Popularity | Favorites
Popular Categories: Popularity | Our Choices | All-Round Favorites | Title Topselling Categories: Popularity | Our Choices | All-Round Favorites | Title