OriGene cDNA clones in recent publications

Expression and Function of Epithelial Anoctamins J. Biol. Chem., Mar 2010; 285: 7838 - 7845 [ANO10]

Retinoid-suppressed phosphorylation of RARa mediates the differentiation pathway of osteosarcoma cells Oncogene (1 March 2010) doi:10.1038/onc.2010.50 Original Article [RARA]

A chemical and phosphoproteomic characterization of dasatinib action in lung cancer Nature Chemical Biology (28 February 2010) doi:10.1038/nchembio.332 Article [PTK6]

A Comparison of the Roles of Peroxisome Proliferator-Activated Receptor and Retinoic Acid Receptor on CYP26 Regulation Mol. Pharmacol., Feb 2010; 77: 218 - 227 [CYP26B1]

View All Citations >>

Custom Request form for Clone Modification

* OriGene Clone To Be Modified:	Please enter OriGene Catalog Number only, e.g. RC200003
Modification Needed	Example #1: Mutate nucleotide position 359 G to T, resulting in an alanine into threonine substitution in codon 87 (A87T). Subclone the mutated insert into PS100019 for N-teminus GFP tagging. Example #2: Subclone the indicated sequence from the parental clone into PS100031 vector for domain expression. ATGGTGGCCCGGTTAAGGGCTCGGTAGCTCTGTAGCTGGAGCTGAG
* Plasmid Needed (µg)

* First Name
* Last Name
* Email Address
* Institution Name
* Country
* Phone

* is required field

Copyright © 2010 OriGene Technologies, Inc. All Rights Reserved. Legal Notices.
9620 Medical Center Dr., Suite 200, Rockville, MD 20850 • 1.888.267.4436

Reproduction of any materials from this website is strictly forbidden without permission.