OriGene Technologies, Inc.
Search:    
About FL cDNA Clones RNAi Gene Expression Lysates and Proteins Antibodies Tissue Other Products Tech Support
orange

Related Products
Product Manual

Over 1000 citations of OriGene cDNA clones
Silencing hsp25/hsp27 Gene Expression Augments Proteasome Activity and Increases CD8+ T-Cell–Mediated Tumor Killing and Memory Responses Cancer Prevention Research, Jan 2012; 5: 122 - 137. [HSPB1 ]

Activation of Androgen Receptor, Lipogenesis, and Oxidative Stress Converged by SREBP-1 Is Responsible for Regulating Growth and Progression of Prostate Cancer Cells Mol. Cancer Res., Jan 2012; 10: 133 - 142. [SREBF1 ]

Androgen Deprivation Causes Epithelial–Mesenchymal Transition in the Prostate: Implications for Androgen-Deprivation Therapy Cancer Res., Jan 2012; 72: 527 - 536. [AR ]

CB2 Cannabinoid Receptors Promote Neural Progenitor Cell Proliferation via mTORC1 Signaling J. Biol. Chem., Jan 2012; 287: 1198 - 1209. [Cnr2 ]

View All Citations >>

 

 

Custom Request form for Clone Modification

divider

* OriGene Clone To Be Modified: Please enter OriGene Catalog Number only, e.g. RC200003
Modification Needed
Example #1: Mutate nucleotide position 359 G to T, resulting in an alanine into threonine substitution in codon 87 (A87T). Subclone the mutated insert into PS100019 for N-teminus GFP tagging.

Example #2: Subclone the indicated sequence from the parental clone into PS100031 vector for domain expression. ATGGTGGCCCGGTTAAGGGCTCGGTAGCTCTGTAGCTGGAGCTGAG
* Plasmid Needed (µg)
spacer
* First Name
* Last Name
* Email Address
* Institution Name
* Country
* Phone
    
* is required field
bar
Inc 5000 Healthcare Company Copyright © 2012 OriGene Technologies, Inc. All Rights Reserved. Legal Notices.
9620 Medical Center Dr., Suite 200, Rockville, MD 20850 • 1.888.267.4436


Reproduction of any materials from this website is strictly forbidden without permission.