OriGene Technologies, Inc.
Search:    
About FL cDNA Clones RNAi Gene Expression Lysates and Proteins Antibodies Tissue Other Products Tech Support
orange


Over 1000 citations of OriGene cDNA clones
MET Receptor Sequence Variants R970C and T992I Lack Transforming Capacity Cancer Res., Aug 2010; 70: 6233 - 6237 [MET]

Methyl 2-Cyano-3,12-dioxooleana-1,9-dien-28-oate Decreases Specificity Protein Transcription Factors and Inhibits Pancreatic Tumor Growth: Role of MicroRNA-27a Mol. Pharmacol., Aug 2010; 78: 226 - 236 [ZBTB10]

Tumor Lymphangiogenesis and Metastasis to Lymph Nodes Induced by Cancer Cell Expression of Podoplanin Am. J. Pathol., Aug 2010; 177: 1004 - 1016 [PDPN]

AML1 is overexpressed in patients with myeloproliferative neoplasms and mediates JAK2V617F-independent overexpression of NF-E2 Blood, Jul 2010; 116: 254 - 266 [RUNX1]

View All Citations >>

 

Custom Request form for Clone Modification

divider

* OriGene Clone To Be Modified: Please enter OriGene Catalog Number only, e.g. RC200003
Modification Needed
Example #1: Mutate nucleotide position 359 G to T, resulting in an alanine into threonine substitution in codon 87 (A87T). Subclone the mutated insert into PS100019 for N-teminus GFP tagging.

Example #2: Subclone the indicated sequence from the parental clone into PS100031 vector for domain expression. ATGGTGGCCCGGTTAAGGGCTCGGTAGCTCTGTAGCTGGAGCTGAG
* Plasmid Needed (µg)
spacer
* First Name
* Last Name
* Email Address
* Institution Name
* Country
* Phone
    
* is required field
bar
Copyright © 2010 OriGene Technologies, Inc. All Rights Reserved. Legal Notices.
9620 Medical Center Dr., Suite 200, Rockville, MD 20850 • 1.888.267.4436


Reproduction of any materials from this website is strictly forbidden without permission.