OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home cDNA Clone Gene Synthesis

Custom Request form for Clone Modification

  • Subcloning the insert into another OriGene’s vector, view vector options.
  • Point mutations of OriGene’s clones
  • Deletion mutants of OriGene’s clones

* OriGene Clone To Be Modified: Please enter OriGene Catalog Number only, e.g. RC200003
Modification Needed
Example #1: Mutate nucleotide position 359 G to T, resulting in an alanine into threonine substitution in codon 87 (A87T). Subclone the mutated insert into PS100019 for N-teminus GFP tagging.

Example #2: Subclone the indicated sequence from the parental clone into PS100031 vector for domain expression. ATGGTGGCCCGGTTAAGGGCTCGGTAGCTCTGTAGCTGGAGCTGAG
* Plasmid Needed (µg)
spacer
* First Name
* Last Name
* Email Address
* Institution Name
* Country
* Phone
    
* is required field
bar
Inc 5000 Healthcare Company