PDGF AA (PDGFA) (NM_002607) Human Untagged Clone
CAT#: SC303226
PDGFA (untagged)-Human platelet-derived growth factor alpha polypeptide (PDGFA), transcript variant 1
"NM_002607" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PDGF AA |
Synonyms | PDGF-A; PDGF1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_002607 edited
GCGCCTCGGGACGCGATGAGGACCTTGGCTTGCCTGCTGCTCCTCGGCTGCGGATACCTC GCCCATGTTCTGGCCGAGGAAGCCGAGATCCCCCGCGAGGTGATCGAGAGGCTGGCCCGC AGTCAGATCCACAGCATCCGGGACCTCCAGCGACTCCTGGAGATAGACTCCGTAGGGAGT GAGGATTCTTTGGACACCAGCCTGAGAGCTCACGGGGTCCATGCCACTAAGCATGTGCCC GAGAAGCGGCCCCTGCCCATTCGGAGGAAGAGAAGCATCGAGGAAGCTGTCCCCGCTGTC TGCAAGACCAGGACGGTCATTTACGAGATTCCTCGGAGTCAGGTCGACCCCACGTCCGCC AACTTCCTGATCTGGCCCCCGTGCGTGGAGGTGAAACGCTGCACCGGCTGCTGCAACACG AGCAGTGTCAAGTGCCAGCCCTCCCGCGTCCACCACCGCAGCGTCAAGGTGGCCAAGGTG GAATACGTCAGGAAGAAGCCAAAATTAAAAGAAGTCCAGGTGAGGTTAGAGGAGCATTTG GAGTGCGCCTGCGCGACCACAAGCCTGAATCCGGATTATCGGGAAGAGGACACGGGAAGG CCTAGGGAGTCAGGTAAAAAACGGAAAAGAAAAAGGTTAAAACCCACCTAA |
Restriction Sites | Please inquire |
ACCN | NM_002607 |
Insert Size | 600 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | no |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002607.4, NP_002598.4 |
RefSeq Size | 2818 bp |
RefSeq ORF | 636 bp |
Locus ID | 5154 |
UniProt ID | P04085 |
Cytogenetics | 7p22.3 |
Protein Families | Druggable Genome |
Protein Pathways | Cytokine-cytokine receptor interaction, Focal adhesion, Gap junction, Glioma, MAPK signaling pathway, Melanoma, Pathways in cancer, Prostate cancer, Regulation of actin cytoskeleton |
Gene Summary | This gene encodes a member of the protein family comprised of both platelet-derived growth factors (PDGF) and vascular endothelial growth factors (VEGF). The encoded preproprotein is proteolytically processed to generate platelet-derived growth factor subunit A, which can homodimerize, or alternatively, heterodimerize with the related platelet-derived growth factor subunit B. These proteins bind and activate PDGF receptor tyrosine kinases, which play a role in a wide range of developmental processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). The protein contains a C-terminal basic motif encoded by exon 6, the exon missing in variant 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and experimental evidence. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223058 | PDGFA (Myc-DDK-tagged)-Human platelet-derived growth factor alpha polypeptide (PDGFA), transcript variant 1 |
USD 450.00 |
|
RC223058L1 | Lenti ORF clone of Human platelet-derived growth factor alpha polypeptide (PDGFA), transcript variant 1, Myc-DDK-tagged |
USD 750.00 |
|
RC223058L2 | Lenti ORF clone of Human platelet-derived growth factor alpha polypeptide (PDGFA), transcript variant 1, mGFP tagged |
USD 750.00 |
|
RC223058L3 | Lenti ORF clone of Human platelet-derived growth factor alpha polypeptide (PDGFA), transcript variant 1, Myc-DDK-tagged |
USD 750.00 |
|
RC223058L4 | Lenti ORF clone of Human platelet-derived growth factor alpha polypeptide (PDGFA), transcript variant 1, mGFP tagged |
USD 750.00 |
|
RG223058 | PDGFA (tGFP-tagged) - Human platelet-derived growth factor alpha polypeptide (PDGFA), transcript variant 1 |
USD 650.00 |
{0} Product Review(s)
Be the first one to submit a review