OriGene Technologies, Inc.
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home cDNA Clone TrueClone Selectable Vectors

CLONING AND SELECTABLE VECTORS

All OriGene TrueClones are provided in a pCMV6 Cloning Vector and all are available for purchase as negative controls.

emptypCMV6vector

Some of the TrueClones are provided in pCMV6-Entry vector. The native stop codon is present in the cDNA insert, therefore the C-terminal tag won’t be expressed

pCMV6-Entry vector
Primer namePrimer sequence (for sequencing)
VP1.5 (forward)5' GGACTTTCCAAAATGTCG 3'
XL39 (reverse)5' ATTAGGACAAGGCTGGTGGG 3'

View Location on Vectors
Add to cart

In addition, OriGene is offering a Neomycin resistant version of its pCMV cloning vector as a kit to those customer who wish to create a stable cell line from our TrueClones

pCMV-Neo vector

Vector Sequences:

Key Functional Features of pCMV6-XL4, XL5 & XL6 vectors:

  • Vector size: 4.7kb
  • Selection marker in E. coli: Ampicillin-resistance
  • Selection marker in mammalian cells: None. For transient transfection only
  • Promoter for in vivo expression in mammalian cells: CMV promoter
  • Promoter for in vitro cell free system: T7 (for pCMV6-XL4 and pCMV6-XL5) and SP6 for (pCMV6-XL6)
  • Cloning sites: EcoRI and SalI. While EcoRI is still preserved, SalI is destroyed upon cloning.
  • Restriction sites for removing insert: NotI. *Two NotI sites are flanking the cloning sites in the vector.
  • Cell line suitable for transfection: COS, 293, Hela, CHO, NIH3T3, Mouse L cell, etc.
  • Transcription termination and polyadenylation signals: from human growth hormone (hGH) gene.

VectorMap

Extensive work has been done to engineer the vector to achieve high level of transgene expression level. When compared with another popular expression plasmid, pCDNA3.1 (Invitrogen), pCMV-based plasmids provide comparable if not higher level transgene expression.

Comparison of pCMV to pCDNA3

Fig 1. Comparison of transgene expression level in pCMV6- and pCDNA3.1-based plasmids. CAT gene was cloned downstream of the promoters in the pCMV6 and pCDNA3.1 vectors. In three independent experiments, a same quantity of plasmid DNA was transfected into COS1 cell and the CAT activity was scored.

References:
Cloning, structure and expression of the mitochondrial cytochrome P-450 sterol 26-hydroxylase, a bile acid biosynthetic enzyme. J Biol Chem. 1989 May 15; 264(14): 8222-9. Andersson S, Davis DL, Dahlback H, Jornvall H, Russell DW.

Expression cloning and regulation of steroid 5 alpha-reductase, an enzyme essential for male sexual differentiation. J Biol Chem. 1989 Sep 25;264(27):16249-55. Andersson S, Bishop RW, Russell DW

 

bar
Inc 5000 Healthcare Company Copyright © 2014 OriGene Technologies, Inc. All Rights Reserved. Legal Notices.
9620 Medical Center Dr., Suite 200, Rockville, MD 20850 • 1.888.267.4436

Reproduction of any materials from this website is strictly forbidden without permission.

All Products by: Title | Price | Category | Popularity | Best Sellers Topselling Products by: Title | Price | Category | Popularity | Favorites
Popular Categories: Popularity | Our Choices | All-Round Favorites | Title Topselling Categories: Popularity | Our Choices | All-Round Favorites | Title