Elovl1 (NM_001039176) Mouse Untagged Clone

CAT#: MC226748

Elovl1 (untagged) - Mouse elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 (Elovl1), transcript variant 1

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Elovl1
• Synonyms: AA407424; BB151133; Ssc1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226748 representing NM_001039176
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGGCTGTTGTGAACTTGTACCACGAGCTGATGAAGCATGCGGATCCCCGGATCCAAAGCTACCCTC
  TGATGGGGTCCCCCTTGCTAATAACATCCATCCTTCTGACCTATGTGTACTTCATCCTATCGCTTGGGCC
  TCGAATCATGGCTAATCGGAAGCCCTTCCAACTTCGAGGCTTCATGATTGTCTACAATTTCTCACTGGTG
  ATACTCTCCCTCTACATTGTCTATGAGTTTCTGATGTCTGGTTGGCTGAGTACCTACACCTGGCGCTGTG
  ACCCCATAGACTTTTCCAATAGCCCTGAAGCACTTCGGATGGTTCGAGTGGCCTGGCTCTTCATGCTTTC
  CAAGGTCATTGAGCTGATGGACACAGTGATATTTATCCTCCGGAAGAAGGACGGGCAAGTGACCTTCCTC
  CATGTCTTCCACCACTCGGTGCTTCCCTGGAGTTGGTGGTGGGGGATAAAAATTGCTCCAGGAGGAATGG
  GCTCCTTCCATGCCATGATAAACTCCTCTGTACATGTCGTCATGTACCTCTACTATGGATTGTCTGCCCT
  TGGCCCTGTGGCCCAGCCCTACCTTTGGTGGAAGAAACATATGACTGCCATTCAGCTGATCCAGTTTGTC
  CTGGTCTCACTGCACATCAGCCAATACTACTTCATGCCCAGCTGCAACTACCAGTACCCCATCATCATCC
  ACCTCATCTGGATGTATGGCACCATCTTCTTCATACTGTTCTCCAATTTCTGGTATCACTCTTACACCAA
  GGGGAAGCGGCTGCCCCGTGCAGTTCAGCAAAATGGAGCTCCAGCTACCACCAAGGTCAAGGCCAACTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001039176
• Insert Size: 840 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001039176.2, NP_001034265.1
• RefSeq Size: 1833 bp
• RefSeq ORF: 840 bp
• Locus ID: 54325
• UniProt ID: Q9JLJ5
• Cytogenetics: 4 D2.1
• Gene Summary: Catalyzes the first and rate-limiting reaction of the four reactions that constitute the long-chain fatty acids elongation cycle. This endoplasmic reticulum-bound enzymatic process allows the addition of 2 carbons to the chain of long- and very long-chain fatty acids (VLCFAs) per cycle. Condensing enzyme that exhibits activity toward saturated and monounsaturated acyl-CoA substrates, with the highest activity towards C22:0 acyl-CoA. May participate in the production of both saturated and monounsaturated VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators. Important for saturated C24:0 and monounsaturated C24:1 sphingolipid synthesis. Indirectly inhibits RPE65 via production of VLCFAs.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longest transcript. Variants 1 and 2 encode the same isoform (1).