PD-L1 (Cd274) (NM_021893) Mouse Untagged Clone

CAT#: MC201908

PD-L1 / CD274 (untagged) - Mouse PD-L1 / CD274 antigen (PD-L1 / CD274), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Symbol: PD-L1
• Synonyms: A530045L16Rik; B7h1; PD-; Pdcd1l; Pdcd1l1; Pdcd1lg1; Pdl1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC201908 representing NM_021893.
  Blue=ORF Red=Cloning site Green=Tag(s)
  
  CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCGGCG
  CGCCAGATCTCAAGCTTAACTAGCTAGCGGACCGAC
  ATGAGGATATTTGCTGGCATTATATTCACAGCCTGCTGTCACTTGCTACGGGCGTTTACTATCACGGCT
  CCAAAGGACTTGTACGTGGTGGAGTATGGCAGCAACGTCACGATGGAGTGCAGATTCCCTGTAGAACGG
  GAGCTGGACCTGCTTGCGTTAGTGGTGTACTGGGAAAAGGAAGATGAGCAAGTGATTCAGTTTGTGGCA
  GGAGAGGAGGACCTTAAGCCTCAGCACAGCAACTTCAGGGGGAGAGCCTCGCTGCCAAAGGACCAGCTT
  TTGAAGGGAAATGCTGCCCTTCAGATCACAGACGTCAAGCTGCAGGACGCAGGCGTTTACTGCTGCATA
  ATCAGCTACGGTGGTGCGGACTACAAGCGAATCACGCTGAAAGTCAATGCCCCATACCGCAAAATCAAC
  CAGAGAATTTCCGTGGATCCAGCCACTTCTGAGCATGAACTAATATGTCAGGCCGAGGGTTATCCAGAA
  GCTGAGGTAATCTGGACAAACAGTGACCACCAACCCGTGAGTGGGAAGAGAAGTGTCACCACTTCCCGG
  ACAGAGGGGATGCTTCTCAATGTGACCAGCAGTCTGAGGGTCAACGCCACAGCGAATGATGTTTTCTAC
  TGTACGTTTTGGAGATCACAGCCAGGGCAAAACCACACAGCGGAGCTGATCATCCCAGAACTGCCTGCA
  ACACATCCTCCACAGAACAGGACTCACTGGGTGCTTCTGGGATCCATCCTGTTGTTCCTCATTGTAGTG
  TCCACGGTCCTCCTCTTCTTGAGAAAACAAGTGAGAATGCTAGATGTGGAGAAATGTGGCGTTGAAGAT
  ACAAGCTCAAAAAACCGAAATGATACACAATTCGAGGAGACGTAA
  ACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAG
  GATGACGACGATAAGGTTTAAACGGCCGGCCGCGGT
  
• Restriction Sites: RsrII-NotI
• ACCN: NM_021893
• Insert Size: 873 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC066841
• RefSeq Size: 3653 bp
• RefSeq ORF: 873 bp
• Locus ID: 60533
• UniProt ID: Q9EP73
• Cytogenetics: 19 C1
• MW: 32.8 kDa
• Gene Summary: The protein encoded by this gene is an immune inhibitory receptor ligand that is expressed by hematopoietic and non-hematopoietic cells, such as T cells and B cells and various types of tumor cells. The encoded protein is a type I transmembrane protein that has immunoglobulin V-like and C-like domains. Interaction of this ligand with its receptor inhibits T-cell activation and cytokine production. During infection or inflammation of normal tissue, this interaction is important for preventing autoimmunity by maintaining homeostasis of the immune response. In tumor microenvironments, this interaction provides an immune escape for tumor cells through cytotoxic T-cell inactivation. Mice deficient for this gene display a variety of phenotypes including decreased allogeneic fetal survival rates and severe experimental autoimmune encephalomyelitis. [provided by RefSeq, Sep 2015]