OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home cDNA Clone miRNA MicroRNA Plasmid

Mir150 (MI0000172) MicroRNA

Specifications Citations (2) Related Products Product Documents
SKU ACCN Description Price Availability
SC400788 MI0000172 Expression plasmid for mouse microRNA Mir150 $330 In Stock
       Add to Cart

Also for Mir150 (MI0000172)

OriGene TrueClone Data
Vector:pCMV-MIR
Sequence Data:
(Full insert)
Precursor:CCCUGUCUCCCAACCCUUGUACCAGUGCUGUGCCUCAGACCCUGGUACAGG
CCUGGGGGAUAGGG
Mature Sequence:UCUCCCAACCCUUGUACCAGUG
OTI Disclaimer:All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA
Product Components:The plasmid is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Also Contains:
Both mature and minor (star) miRNA can be over expressed from the construct.

Reference Data
RefSeq: MI0000172,
Synonyms : Mirn150 mmu-mir-150
Locus ID: 387168
Summary:

 

Inc 5000 Healthcare Company