OriGene Technologies, Inc.
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home cDNA Clone miRNA MicroRNA Plasmid

MIR27B (MI0000440) MicroRNA

Specifications Citations (1) Related Products Product Documents
SKU ACCN Description Price Availability
SC400303 MI0000440 Expression plasmid for human microRNA MIR27B $325 Next Day
       Add to Cart

Also for MIR27B (MI0000440)

OriGene TrueClone Data
Vector:pCMV-MIR
Sequence Data:
(Full insert)
Precursor:ACCUCUCUAACAAGGUGCAGAGCUUAGCUGAUUGGUGAACAGUGAUUGGUU
UCCGCUUUGUUCACAGUGGCUAAGUUCUGCACCUGAAGAGAAGGUG
Mature Sequence:AGAGCUUAGCUGAUUGGUGAAC
OTI Disclaimer:All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA
Product Components:The plasmid is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Also Contains:
Both mature and minor (star) miRNA can be over expressed from the construct.

Reference Data
RefSeq: MI0000440,
Synonyms : MIRN27B miRNA27B
Locus ID: 407019
Summary:

 

Inc 5000 Healthcare Company Copyright © 2014 OriGene Technologies, Inc. All Rights Reserved. Legal Notices.
9620 Medical Center Dr., Suite 200, Rockville, MD 20850 • 1.888.267.4436

Reproduction of any materials from this website is strictly forbidden without permission.

All Products by: Title | Price | Category | Popularity | Best Sellers Topselling Products by: Title | Price | Category | Popularity | Favorites
Popular Categories: Popularity | Our Choices | All-Round Favorites | Title Topselling Categories: Popularity | Our Choices | All-Round Favorites | Title