Amyloid Precursor Protein (APP) Human qPCR Primer Pair (NM_000484)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
APP (Myc-DDK-tagged)-Human amyloid beta (A4) precursor protein (APP), transcript variant 1
USD 1,057.00
Anti-APP (Amyloid beta precursor protein) mouse monoclonal antibody, clone OTI7G9 (formerly 7G9)
USD 447.00
Other products for "APP"
Specifications
Product Data | |
Gene ID | 351 |
Forward Sequence | CCTTCTCGTTCCTGACAAGTGC |
Reverse Sequence | GGCAGCAACATGCCGTAGTCAT |
Accession No | NM_000484, NM_000484.1, NM_000484.2, NM_000484.3, BC065529, BC065529.1, BC004369, BC065523, BE907745, BI559391, BM172428, BM876312, NM_000484.4 |
UniProt ID | P05067 |
Synonyms | AAA; ABETA; ABPP; AD1; alpha-sAPP; APPI; CTFgamma; CVAP; PN-II; PN2; preA4 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.