OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home CRISPR-CAS9 KN302378

C3ar1 - mouse gene knockout kit via CRISPR

divider

Specifications  Citations  Validation Data  FAQ
SKU Description Price Availability Manual  
KN302378 C3ar1 - mouse gene knockout kit via CRISPR $1200 4 weeks Manual PDF Add to Shopping Cart
spacer
Also for C3ar1 (Locus ID 12267)
cDNA Clone shRNA/siRNA CRISPR KO Kit Protein Request Antibody
SKU Description Donor Vector Price Availability  
KN302378RB C3ar1 - mouse gene knockout kit via CRISPR RFP-BSD 1290 4 weeks
KN302378LP C3ar1 - mouse gene knockout kit via CRISPR Luciferase-Puro 1290 4 Weeks
KN302378BN C3ar1 - mouse gene knockout kit via CRISPR mBFP-Neo 1290 4 Weeks
Add to Shopping Cart

Comparing to KN302378, the above kits contain:

  • Identical gRNA vectors
  • Identical LHA & RHA
  • Different donor cassette
kn_donor_diagram
Kit Components
KN302378G1, C3ar1 gRNA vector 1 in pCas-Guide vector, Target Sequence: TGAGTGTAGGTCAGTTGAAT
KN302378G2, C3ar1 gRNA vector 2 in pCas-Guide vector, Target Sequence: ACCATGGAGGCAATGTCTTG
KN302378D, donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
Homologous arm and GFP-puro sequences   
GE100003, scramble sequence in pCas-Guide vector

Disclaimer
The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data
RefSeq: BC003728NM_009779
Synonyms: AZ3B, C3AR, HNFAG09
Summary: Receptor for the chemotactic and inflammatory peptide anaphylatoxin C3a. This receptor stimulates chemotaxis, granule enzyme release and superoxide anion production. [UniProtKB/Swiss-Prot Function]

Learn more about CRISPR?

Diagram-Gene Editing RecombII


 

pattern
Inc 5000 Healthcare Company