OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home CRISPR-CAS9 KN219458

BTLA - human gene knockout kit via CRISPR

divider

Specifications  Citations  Validation Data  FAQ
SKU Description Price Availability Manual  
KN219458 BTLA - human gene knockout kit via CRISPR $1200 4 Weeks Manual PDF Add to Shopping Cart
spacer
Also for BTLA (Locus ID 151888)
cDNA Clone shRNA/siRNA CRISPR KO Kit Protein Request Antibody
SKU Description Donor Vector Price Availability  
KN219458RB BTLA - human gene knockout kit via CRISPR RFP-BSD 1290 4 Weeks
KN219458LP BTLA - human gene knockout kit via CRISPR Luciferase-Puro 1290 4 Weeks
KN219458BN BTLA - human gene knockout kit via CRISPR mBFP-Neo 1290 4 Weeks
Add to Shopping Cart

Comparing to KN219458, the above kits contain:

  • Identical gRNA vectors
  • Identical LHA & RHA
  • Different donor cassette
kn_donor_diagram
Kit Components
KN219458G1, BTLA gRNA vector 1 in pCas-Guide vector, Target Sequence: TAATCCCATATCTGGACATC
KN219458G2, BTLA gRNA vector 2 in pCas-Guide vector, Target Sequence: TTGCCTGCCATGCTTGGAAC
KN219458D, donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
Homologous arm and GFP-puro sequences   
GE100003, scramble sequence in pCas-Guide vector

Disclaimer
The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data
RefSeq: NM_001085357NM_181780XM_011512447XM_017005748
Synonyms: BTLA1; CD272
Summary: This gene encodes a member of the immunoglobulin superfamily. The encoded protein contains a single immunoglobulin (Ig) domain and is a receptor that relays inhibitory signals to suppress the immune response. Alternative splicing results in multiple transcript variants. Polymorphisms in this gene have been associated with an increased risk of rheumatoid arthritis. [provided by RefSeq, Aug 2011].

Learn more about CRISPR?

Diagram-Gene Editing RecombII


 

pattern
Inc 5000 Healthcare Company