OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home CRISPR-CAS9 KN207280

DTL - human gene knockout kit via CRISPR

divider

Specifications  Citations  Validation Data  FAQ
SKU Description Price Availability Manual  
KN207280 DTL - human gene knockout kit via CRISPR $1200 4 Weeks Manual PDF Add to Shopping Cart
spacer
SKU Description Donor Vector Price Availability  
KN207280RB DTL - human gene knockout kit via CRISPR RFP-BSD 1290 4 Weeks
KN207280LP DTL - human gene knockout kit via CRISPR Luciferase-Puro 1290 4 Weeks
KN207280BN DTL - human gene knockout kit via CRISPR mBFP-Neo 1290 4 Weeks
Add to Shopping Cart

Comparing to KN207280, the above kits contain:

  • Identical gRNA vectors
  • Identical LHA & RHA
  • Different donor cassette
kn_donor_diagram
Kit Components
KN207280G1, DTL gRNA vector 1 in pCas-Guide vector, Target Sequence: TAACGGTCCCAACCGCTGCT
KN207280G2, DTL gRNA vector 2 in pCas-Guide vector, Target Sequence: GCCAGCTCCGAGCAGCGGTT
KN207280D, donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
Homologous arm and GFP-puro sequences   
GE100003, scramble sequence in pCas-Guide vector

Disclaimer
The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data
RefSeq: NM_001286229NM_001286230NM_016448XM_011509614
Synonyms: CDT2; DCAF2; L2DTL; RAMP
Summary:

Learn more about CRISPR?

Diagram-Gene Editing RecombII


 

pattern
Inc 5000 Healthcare Company