OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home CRISPR-CAS9 KN207053

GAL - human gene knockout kit via CRISPR

divider

Specifications  Citations  Validation Data  FAQ
SKU Description Price Availability Manual  
KN207053 GAL - human gene knockout kit via CRISPR $1200 7 days * Manual PDF Add to Shopping Cart

* Business Days

spacer
SKU Description Donor Vector Price Availability  
KN207053RB GAL - human gene knockout kit via CRISPR RFP-BSD 1290 4 Weeks
KN207053LP GAL - human gene knockout kit via CRISPR Luciferase-Puro 1290 4 Weeks
KN207053BN GAL - human gene knockout kit via CRISPR mBFP-Neo 1290 4 Weeks
Add to Shopping Cart

Comparing to KN207053, the above kits contain:

  • Identical gRNA vectors
  • Identical LHA & RHA
  • Different donor cassette
kn_donor_diagram
Kit Components
KN207053G1, GAL gRNA vector 1 in pCas-Guide vector, Target Sequence: TCTGGTCGCCGGTAAGTGCG
KN207053G2, GAL gRNA vector 2 in pCas-Guide vector, Target Sequence: AGGCAGAAAGGGCCGCGGCG
KN207053D, donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
Homologous arm and GFP-puro sequences   
GE100003, scramble sequence in pCas-Guide vector

Disclaimer
The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data
RefSeq: NM_015973
Synonyms: GAL-GMAP; GALN; GLNN; GMAP
Summary: This gene encodes a neuroendocrine peptide that is widely expressed in the central and peripheral nervous systems and also the gastrointestinal tract, pancreas, adrenal gland and urogenital tract. The encoded protein is a precursor that is proteolytically processed to generate two mature peptides: galanin and galanin message-associated peptide (GMAP). Galanin has diverse physiological functions including nociception, feeding and energy homeostasis, osmotic regulation and water balance. GMAP has been demonstrated to possess antifungal activity and hypothesized to be part of the innate immune system. [provided by RefSeq, Jul 2015]

Learn more about CRISPR?

Diagram-Gene Editing RecombII


 

pattern
Inc 5000 Healthcare Company