OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home CRISPR-CAS9 KN200226

TGM2 - human gene knockout kit via CRISPR

divider

Specifications  Citations  Validation Data  FAQ
SKU Description Price Availability Manual  
KN200226 TGM2 - human gene knockout kit via CRISPR $1200 4 Weeks Manual PDF Add to Shopping Cart
spacer
SKU Description Donor Vector Price Availability  
KN200226RB TGM2 - human gene knockout kit via CRISPR RFP-BSD 1290 4 Weeks
KN200226LP TGM2 - human gene knockout kit via CRISPR Luciferase-Puro 1290 4 Weeks
KN200226BN TGM2 - human gene knockout kit via CRISPR mBFP-Neo 1290 4 Weeks
Add to Shopping Cart

Comparing to KN200226, the above kits contain:

  • Identical gRNA vectors
  • Identical LHA & RHA
  • Different donor cassette
kn_donor_diagram
Kit Components
KN200226G1, TGM2 gRNA vector 1 in pCas-Guide vector, Target Sequence: GTGACTCTGATACTCACCCT
KN200226G2, TGM2 gRNA vector 2 in pCas-Guide vector, Target Sequence: TTAGGGATTCAGCTCCCACC
KN200226D, donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
Homologous arm and GFP-puro sequences   
GE100003, scramble sequence in pCas-Guide vector

Disclaimer
The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data
RefSeq: NM_004613NM_198951XM_011529028
Synonyms: G-ALPHA-h; GNAH; HEL-S-45; TG2; TGC
Summary: Catalyzes the cross-linking of proteins and the conjugation of polyamines to proteins. [UniProtKB/Swiss-Prot Function]

Learn more about CRISPR?

Diagram-Gene Editing RecombII


 

pattern
Inc 5000 Healthcare Company