OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home CRISPR-CAS9 KN316845

Stat3 - mouse gene knockout kit via CRISPR

divider

Specifications  Citations (1)  Validation Data  FAQ
SKU Description Price Availability Manual  
KN316845 Stat3 - mouse gene knockout kit via CRISPR $1200 4 weeks Manual PDF Add to Shopping Cart
spacer
Also for Stat3 (Locus ID 20848)
cDNA Clone shRNA/siRNA CRISPR KO Kit Protein Request Antibody
SKU Description Donor Vector Price Availability  
KN316845RB Stat3 - mouse gene knockout kit via CRISPR RFP-BSD 1290 4 weeks
KN316845LP Stat3 - mouse gene knockout kit via CRISPR Luciferase-Puro 1290 4 Weeks
KN316845BN Stat3 - mouse gene knockout kit via CRISPR mBFP-Neo 1290 4 Weeks
Add to Shopping Cart

Comparing to KN316845, the above kits contain:

  • Identical gRNA vectors
  • Identical LHA & RHA
  • Different donor cassette
kn_donor_diagram
Kit Components
KN316845G1, Stat3 gRNA vector 1 in pCas-Guide vector, Target Sequence: GTACAGCGACAGCTTCCCCA
KN316845G2, Stat3 gRNA vector 2 in pCas-Guide vector, Target Sequence: GCAGCTGGACACACGCTACC
KN316845D, donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
Homologous arm and GFP-puro sequences   
GE100003, scramble sequence in pCas-Guide vector

Disclaimer
The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data
RefSeq: BC003806BC019168NM_011486NM_213659NM_213660
Synonyms: 1110034C02Rik; Aprf; AW109958
Summary: The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. This protein mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis. The small GTPase Rac1 has been shown to bind and regulate the activity of this protein. PIAS3 protein is a specific inhibitor of this protein. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2015].

Learn more about CRISPR?

Diagram-Gene Editing RecombII


 

pattern
Inc 5000 Healthcare Company