OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home CRISPR-CAS9 KN214877

EGFR - human gene knockout kit via CRISPR

divider

Specifications  Citations (1)  Validation Data  FAQ
SKU Description Price Availability Manual  
KN214877 EGFR - human gene knockout kit via CRISPR $1200 7 Days * Manual PDF Add to Shopping Cart

* Business Days

spacer
SKU Description Donor Vector Price Availability  
KN214877RB EGFR - human gene knockout kit via CRISPR RFP-BSD 1290 4 Weeks
KN214877LP EGFR - human gene knockout kit via CRISPR Luciferase-Puro 1290 4 Weeks
KN214877BN EGFR - human gene knockout kit via CRISPR mBFP-Neo 1290 4 Weeks
Add to Shopping Cart

Comparing to KN214877, the above kits contain:

  • Identical gRNA vectors
  • Identical LHA & RHA
  • Different donor cassette
kn_donor_diagram
Kit Components
KN214877G1, EGFR gRNA vector 1 in pCas-Guide vector, Target Sequence: TCCTCCAGAGCCCGACTCGC
KN214877G2, EGFR gRNA vector 2 in pCas-Guide vector, Target Sequence: GCTGCCCCGGCCGTCCCGGA
KN214877D, donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
Homologous arm and GFP-puro sequences   
GE100003, scramble sequence in pCas-Guide vector

Disclaimer
The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data
RefSeq: NM_005228NM_201282NM_201283NM_201284
Synonyms: ERBB; ERBB1; HER1; mENA; NISBD2; PIG61
Summary: Isoform 2 may act as an antagonist of EGF action. [UniProtKB/Swiss-Prot Function]

Learn more about CRISPR?

Diagram-Gene Editing RecombII


 

pattern
Inc 5000 Healthcare Company