OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home CRISPR-CAS9 KN206029

SLC20A2 - human gene knockout kit via CRISPR

divider

Specifications  Citations (1)  Validation Data  FAQ
SKU Description Price Availability Manual  
KN206029 SLC20A2 - human gene knockout kit via CRISPR $1200 7 Days * Manual PDF Add to Shopping Cart

* Business Days

spacer
Also for SLC20A2 (Locus ID 6575)
cDNA Clone shRNA/siRNA CRISPR KO Kit Protein Request Antibody
SKU Description Donor Vector Price Availability  
KN206029RB SLC20A2 - human gene knockout kit via CRISPR RFP-BSD 1290 7 Days
KN206029LP SLC20A2 - human gene knockout kit via CRISPR Luciferase-Puro 1290 4 Weeks
KN206029BN SLC20A2 - human gene knockout kit via CRISPR mBFP-Neo 1290 4 Weeks
Add to Shopping Cart

Comparing to KN206029, the above kits contain:

  • Identical gRNA vectors
  • Identical LHA & RHA
  • Different donor cassette
kn_donor_diagram
Kit Components
KN206029G1, SLC20A2 gRNA vector 1 in pCas-Guide vector, Target Sequence: AACGATGTTGCCAACTCCTT
KN206029G2, SLC20A2 gRNA vector 2 in pCas-Guide vector, Target Sequence: CATCCACAAATACTCATCCA
KN206029D, donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
Homologous arm and GFP-puro sequences   
GE100003, scramble sequence in pCas-Guide vector

Disclaimer
The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data
RefSeq: NM_001257180NM_001257181NM_006749XM_005273613XM_005273615XM_006716390XM_006716391XM_017013748XM_017013749XM_017013750XM_017013751XM_017013752
Synonyms: GLVR-2; GLVR2; IBGC1; IBGC3; MLVAR; PIT-2; PIT2; Ram-1; RAM1
Summary: This gene encodes a member of the inorganic phosphate transporter family. The encoded protein is a type 3 sodium-dependent phosphate symporter that plays an important role in phosphate homeostasis by mediating cellular phosphate uptake. The encoded protein also confers susceptibility to viral infection as a gamma-retroviral receptor. Mutations in this gene may play a role in familial idiopathic basal ganglia calcification. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012].

Learn more about CRISPR?

Diagram-Gene Editing RecombII


 

pattern
Inc 5000 Healthcare Company