OriGene Logo
Search:    
Left ProductsProducts divider ServicesServices divider technologyTechnology divider researchResearch divider TechsupportTechSupport divider AboutAbout Right
 
Home CRISPR-CAS9 KN200700

PML - human gene knockout kit via CRISPR

divider

Specifications  Citations (1)  Validation Data  FAQ
SKU Description Price Availability Manual  
KN200700 PML - human gene knockout kit via CRISPR $1200 4 Weeks Manual PDF Add to Shopping Cart
spacer
SKU Description Donor Vector Price Availability  
KN200700RB PML - human gene knockout kit via CRISPR RFP-BSD 1290 4 Weeks
KN200700LP PML - human gene knockout kit via CRISPR Luciferase-Puro 1290 4 Weeks
KN200700BN PML - human gene knockout kit via CRISPR mBFP-Neo 1290 4 Weeks
Add to Shopping Cart

Comparing to KN200700, the above kits contain:

  • Identical gRNA vectors
  • Identical LHA & RHA
  • Different donor cassette
kn_donor_diagram
Kit Components
KN200700G1, PML gRNA vector 1 in pCas-Guide vector, Target Sequence: CTCGGAGATCGGGCGGGTGC
KN200700G2, PML gRNA vector 2 in pCas-Guide vector, Target Sequence: GGCCTTCAGAGGGGGTCTCG
KN200700D, donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
Homologous arm and GFP-puro sequences   
GE100003, scramble sequence in pCas-Guide vector

Disclaimer
The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data
RefSeq: NM_002675NM_033238NM_033239NM_033240NM_033242NM_033244NM_033245NM_033246NM_033247NM_033249NM_033250
Synonyms: MYL, RNF71, PP8675, TRIM19;MYL; PP8675; RNF71; TRIM19; promyelocytic leukemia protein; promyelocytic leukemia, inducer of; tripartite motif protein TRIM19; promyelocytic leukemia
Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bodies where it functions as a transcription factor and tumor suppressor. Its expression is cell-cycle related and it regulates the p53 response to oncogenic signals. The gene is often involved in the translocation with the retinoic acid receptor alpha gene associated with acute promyelocytic leukemia (APL). Extensive alternative splicing of this gene results in several variations of the protein's central and C-terminal regions; all variants encode the same N-terminus. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008].

Learn more about CRISPR?

Diagram-Gene Editing RecombII


 

pattern
Inc 5000 Healthcare Company